WormBase Tree Display for Variation: WBVar00143470
expand all nodes | collapse all nodes | view schema
WBVar00143470 | Evidence | Person_evidence | WBPerson10095 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e768 | |||||||
Other_name | CE11540:p.Gly179Glu | ||||||||
F59E12.2.1:c.1310+537C>T | |||||||||
F59E12.12.1:c.536G>A | |||||||||
HGVSg | CHROMOSOME_II:g.5651839C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F59E12 | |||||
Flanking_sequences | ttcccgtttcttcctggttgtccctttgat | caatatttcctggtggtcctggtggcccta | |||||||
Mapping_target | F59E12 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (15) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000252 | |||||||
WBGene00006988 | |||||||||
Transcript | F59E12.12.1 (12) | ||||||||
F59E12.2.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F59E12.2.1:c.1310+537C>T | ||||||||
Intron_number | 5/8 | ||||||||
Interactor (10) | |||||||||
Genetics | Interpolated_map_position | II | -0.988396 | ||||||
Mapping_data | In_2_point | 37 | |||||||
38 | |||||||||
39 | |||||||||
621 | |||||||||
3787 | |||||||||
4219 | |||||||||
4225 | |||||||||
In_multi_point (18) | |||||||||
In_pos_neg_data | 457 | ||||||||
1524 | |||||||||
1526 | |||||||||
1528 | |||||||||
1533 | |||||||||
7119 | |||||||||
Description | Phenotype | WBPhenotype:0000025 | Paper_evidence (2) | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark | adult blistered especially head; enhanced 25C. Easy to score (ES3) old adult. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slightly small; enhanced 25C | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006941 | PATO:0000460 | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00001328 | ||||||||
WBPaper00000031 | |||||||||
WBPaper00000465 | |||||||||
WBPaper00016398 | |||||||||
WBPaper00016094 | |||||||||
WBPaper00061175 | |||||||||
WBPaper00061945 | |||||||||
Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Variation information submitted by WBPerson10095 on 2022-02-17_15:17:42 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||||||
alt_det = g to a mut_det = G179E | Person_evidence | WBPerson10095 | |||||||
Curator_confirmed | WBPerson51134 | ||||||||
Method | Substitution_allele |