WormBase Tree Display for Variation: WBVar00143470
expand all nodes | collapse all nodes | view schema
| WBVar00143470 | Evidence | Person_evidence | WBPerson10095 | ||
|---|---|---|---|---|---|
| Name (3) | |||||
| Sequence_details | SMap | S_parent | Sequence | F59E12 | |
| Flanking_sequences | ttcccgtttcttcctggttgtccctttgat | caatatttcctggtggtcctggtggcccta | |||
| Mapping_target | F59E12 | ||||
| Type_of_mutation | Substitution | c | t | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain (15) | |||||
| Laboratory | CB | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00000252 | |||
| WBGene00006988 | |||||
| Transcript | F59E12.12.1 (12) | ||||
| F59E12.2.1 | VEP_consequence | intron_variant | |||
| VEP_impact | MODIFIER | ||||
| HGVSc | F59E12.2.1:c.1310+537C>T | ||||
| Intron_number | 5/8 | ||||
| Interactor | WBInteraction000052481 | ||||
| WBInteraction000052507 | |||||
| WBInteraction000052510 | |||||
| WBInteraction000052514 | |||||
| WBInteraction000052515 | |||||
| WBInteraction000052528 | |||||
| WBInteraction000052529 | |||||
| WBInteraction000052530 | |||||
| WBInteraction000052534 | |||||
| WBInteraction000052535 | |||||
| Genetics | Interpolated_map_position | II | -0.988396 | ||
| Mapping_data | In_2_point | 37 | |||
| 38 | |||||
| 39 | |||||
| 621 | |||||
| 3787 | |||||
| 4219 | |||||
| 4225 | |||||
| In_multi_point (18) | |||||
| In_pos_neg_data | 457 | ||||
| 1524 | |||||
| 1526 | |||||
| 1528 | |||||
| 1533 | |||||
| 7119 | |||||
| Description (2) | |||||
| Reference | WBPaper00001328 | ||||
| WBPaper00000031 | |||||
| WBPaper00000465 | |||||
| WBPaper00016398 | |||||
| WBPaper00016094 | |||||
| WBPaper00061175 | |||||
| WBPaper00061945 | |||||
| Remark | Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||
| Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
| Variation information submitted by WBPerson10095 on 2022-02-17_15:17:42 via the Allele submission form. Received data and remarks refer to the negative strand sequence (CDS). | Curator_confirmed | WBPerson51134 | |||
| alt_det = g to a mut_det = G179E | Person_evidence | WBPerson10095 | |||
| Curator_confirmed | WBPerson51134 | ||||
| Method | Substitution_allele |
