WormBase Tree Display for Variation: WBVar00143471
expand all nodes | collapse all nodes | view schema
WBVar00143471 | Evidence | Person_evidence | WBPerson10095 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e769 | ||||||
Other_name | C09G5.2a.1:c.797+349C>T | |||||||
C09G5.6.1:c.2647+1G>A | ||||||||
HGVSg | CHROMOSOME_II:g.10711801G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C09G5 | ||||
Flanking_sequences | attcgagagagcatggaggacaagttccag | tagaattgttatgcggaaattatcattaaa | ||||||
Mapping_target | C09G5 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00000064 | |||||||
WBStrain00004206 | ||||||||
WBStrain00004522 | ||||||||
WBStrain00027610 | ||||||||
WBStrain00052605 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00007488 | ||||||
WBGene00000251 | ||||||||
Transcript | C09G5.2a.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | C09G5.2a.1:c.797+349C>T | |||||||
Intron_number | 6/10 | |||||||
C09G5.6.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09G5.6.1:c.2647+1G>A | |||||||
Intron_number | 5/6 | |||||||
Interactor | WBInteraction000537315 | |||||||
Genetics | Interpolated_map_position | II | 3.12418 | |||||
Mapping_data (2) | ||||||||
Description | Phenotype | WBPhenotype:0000025 | Paper_evidence | WBPaper00000031 | ||||
WBPaper00005747 | ||||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
WBPerson2987 | ||||||||
Remark | adult symmetrically blistered, especially head; enhanced 25C. Easy to score (ES3) in older adults. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
temperature sensitive (Table 1) | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000070 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00005747 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors report "abnormal branched annuli (lateral hypodermis)" (Table 1) | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0001412 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 1 | Paper_evidence | WBPaper00005747 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | kaIs12 [col-19::gfp] | Paper_evidence | WBPaper00005747 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00000031 | |||||||
WBPaper00005747 | ||||||||
WBPaper00015964 | ||||||||
WBPaper00061945 | ||||||||
Remark | alt_det = g to a mut_det = gt -> at | Person_evidence | WBPerson10095 | |||||
Curator_confirmed | WBPerson51134 | |||||||
Variation information submitted by WBPerson10095 on 2022-02-17_11:55:46 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||||
Method | Substitution_allele |