WormBase Tree Display for Variation: WBVar00143591
expand all nodes | collapse all nodes | view schema
WBVar00143591 | Evidence | Paper_evidence | WBPaper00002751 | |||
---|---|---|---|---|---|---|
Name | Public_name | e911 | ||||
Other_name | CE39210:p.Met198ThrfsTer7 | |||||
CE45243:p.Met198ThrfsTer7 | ||||||
C01G10.11f.1:c.593_603del | ||||||
CE45264:p.Met107ThrfsTer7 | ||||||
C01G10.11c.1:c.320_330del | ||||||
C01G10.11b.1:c.593_603del | ||||||
CE45251:p.Met58ThrfsTer7 | ||||||
C01G10.11a.1:c.593_603del | ||||||
C01G10.11d.1:c.173_183del | ||||||
CE39211:p.Met198ThrfsTer7 | ||||||
HGVSg | CHROMOSOME_V:g.15076958_15076968del | |||||
Sequence_details | SMap | S_parent | Sequence | C01G10 | ||
Flanking_sequences | cgtttttagtcatgcgatttcactggctcaa | cgaacgatggaatcagttgattcaatgtatt | ||||
Mapping_target | C01G10 | |||||
Type_of_mutation | Deletion | tgatgacggat | Paper_evidence | WBPaper00002751 | ||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain (54) | ||||||
Laboratory | CB | |||||
DR | ||||||
ZHY | ||||||
MTS | ||||||
Status | Live | |||||
Affects | Gene | WBGene00006808 | ||||
WBGene00305285 | ||||||
WBGene00305247 | ||||||
Transcript | C01G10.11f.1 | VEP_consequence | frameshift_variant | |||
VEP_impact | HIGH | |||||
HGVSc | C01G10.11f.1:c.593_603del | |||||
HGVSp | CE45243:p.Met198ThrfsTer7 | |||||
cDNA_position | 717-727 | |||||
CDS_position | 593-603 | |||||
Protein_position | 198-201 | |||||
Exon_number | 7/12 | |||||
Codon_change | aTGATGACGGAT/a | |||||
Amino_acid_change | MMTD/X | |||||
C01G10.11d.1 | VEP_consequence | frameshift_variant | ||||
VEP_impact | HIGH | |||||
HGVSc | C01G10.11d.1:c.173_183del | |||||
HGVSp | CE45251:p.Met58ThrfsTer7 | |||||
cDNA_position | 173-183 | |||||
CDS_position | 173-183 | |||||
Protein_position | 58-61 | |||||
Exon_number | 2/5 | |||||
Codon_change | aTGATGACGGAT/a | |||||
Amino_acid_change | MMTD/X | |||||
C01G10.11b.1 | VEP_consequence | frameshift_variant | ||||
VEP_impact | HIGH | |||||
HGVSc | C01G10.11b.1:c.593_603del | |||||
HGVSp | CE39211:p.Met198ThrfsTer7 | |||||
cDNA_position | 604-614 | |||||
CDS_position | 593-603 | |||||
Protein_position | 198-201 | |||||
Exon_number | 7/10 | |||||
Codon_change | aTGATGACGGAT/a | |||||
Amino_acid_change | MMTD/X | |||||
C01G10.11a.1 | VEP_consequence | frameshift_variant | ||||
VEP_impact | HIGH | |||||
HGVSc | C01G10.11a.1:c.593_603del | |||||
HGVSp | CE39210:p.Met198ThrfsTer7 | |||||
cDNA_position | 601-611 | |||||
CDS_position | 593-603 | |||||
Protein_position | 198-201 | |||||
Exon_number | 7/11 | |||||
Codon_change | aTGATGACGGAT/a | |||||
Amino_acid_change | MMTD/X | |||||
C25D7.19 | ||||||
C01G10.20 | ||||||
C01G10.11c.1 | VEP_consequence | frameshift_variant | ||||
VEP_impact | HIGH | |||||
HGVSc | C01G10.11c.1:c.320_330del | |||||
HGVSp | CE45264:p.Met107ThrfsTer7 | |||||
cDNA_position | 320-330 | |||||
CDS_position | 320-330 | |||||
Protein_position | 107-110 | |||||
Exon_number | 4/7 | |||||
Codon_change | aTGATGACGGAT/a | |||||
Amino_acid_change | MMTD/X | |||||
Interactor | WBInteraction000052100 | |||||
Genetics | Interpolated_map_position | V | 7.32233 | |||
Mapping_data | In_2_point (13) | |||||
In_multi_point (64) | ||||||
In_pos_neg_data | 4288 | |||||
4289 | ||||||
4290 | ||||||
4304 | ||||||
Description (2) | ||||||
Reference (19) | ||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||
Method | Deletion_allele |