WormBase Tree Display for Variation: WBVar00143591
expand all nodes | collapse all nodes | view schema
WBVar00143591 | Evidence | Paper_evidence | WBPaper00002751 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e911 | ||||||
Other_name (10) | ||||||||
HGVSg | CHROMOSOME_V:g.15076958_15076968del | |||||||
Sequence_details | SMap | S_parent | Sequence | C01G10 | ||||
Flanking_sequences | cgtttttagtcatgcgatttcactggctcaa | cgaacgatggaatcagttgattcaatgtatt | ||||||
Mapping_target | C01G10 | |||||||
Type_of_mutation | Deletion | tgatgacggat | Paper_evidence | WBPaper00002751 | ||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (54) | ||||||||
Laboratory | CB | |||||||
DR | ||||||||
ZHY | ||||||||
MTS | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006808 | ||||||
WBGene00305285 | ||||||||
WBGene00305247 | ||||||||
Transcript | C01G10.11f.1 | VEP_consequence | frameshift_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C01G10.11f.1:c.593_603del | |||||||
HGVSp | CE45243:p.Met198ThrfsTer7 | |||||||
cDNA_position | 717-727 | |||||||
CDS_position | 593-603 | |||||||
Protein_position | 198-201 | |||||||
Exon_number | 7/12 | |||||||
Codon_change | aTGATGACGGAT/a | |||||||
Amino_acid_change | MMTD/X | |||||||
C01G10.11d.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C01G10.11d.1:c.173_183del | |||||||
HGVSp | CE45251:p.Met58ThrfsTer7 | |||||||
cDNA_position | 173-183 | |||||||
CDS_position | 173-183 | |||||||
Protein_position | 58-61 | |||||||
Exon_number | 2/5 | |||||||
Codon_change | aTGATGACGGAT/a | |||||||
Amino_acid_change | MMTD/X | |||||||
C01G10.11b.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C01G10.11b.1:c.593_603del | |||||||
HGVSp | CE39211:p.Met198ThrfsTer7 | |||||||
cDNA_position | 604-614 | |||||||
CDS_position | 593-603 | |||||||
Protein_position | 198-201 | |||||||
Exon_number | 7/10 | |||||||
Codon_change | aTGATGACGGAT/a | |||||||
Amino_acid_change | MMTD/X | |||||||
C01G10.11a.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C01G10.11a.1:c.593_603del | |||||||
HGVSp | CE39210:p.Met198ThrfsTer7 | |||||||
cDNA_position | 601-611 | |||||||
CDS_position | 593-603 | |||||||
Protein_position | 198-201 | |||||||
Exon_number | 7/11 | |||||||
Codon_change | aTGATGACGGAT/a | |||||||
Amino_acid_change | MMTD/X | |||||||
C25D7.19 | ||||||||
C01G10.20 | ||||||||
C01G10.11c.1 | VEP_consequence | frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C01G10.11c.1:c.320_330del | |||||||
HGVSp | CE45264:p.Met107ThrfsTer7 | |||||||
cDNA_position | 320-330 | |||||||
CDS_position | 320-330 | |||||||
Protein_position | 107-110 | |||||||
Exon_number | 4/7 | |||||||
Codon_change | aTGATGACGGAT/a | |||||||
Amino_acid_change | MMTD/X | |||||||
Interactor | WBInteraction000052100 | |||||||
Genetics | Interpolated_map_position | V | 7.32233 | |||||
Mapping_data | In_2_point (13) | |||||||
In_multi_point (64) | ||||||||
In_pos_neg_data | 4288 | |||||||
4289 | ||||||||
4290 | ||||||||
4304 | ||||||||
Description | Phenotype (30) | |||||||
Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | No disruption of ASE asymmetry (as seen with lim-6 and gcy-7 reporters) | Paper_evidence | WBPaper00006052 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Genotype | otIs114, otIs6, otIs3 | Paper_evidence | WBPaper00006052 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (19) | ||||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | ||||||||
Method | Deletion_allele |