WormBase Tree Display for Variation: WBVar00143613
expand all nodes | collapse all nodes | view schema
| WBVar00143613 | Evidence | Paper_evidence | WBPaper00013670 | ||
|---|---|---|---|---|---|
| Person_evidence | WBPerson10095 | ||||
| Name (3) | |||||
| Sequence_details | SMap | S_parent | Sequence | C09G5 | |
| Flanking_sequences | cacctcgtcaaccttctggcggatacgatt | agatgggcagactccaccgtcatcgcctag | |||
| Mapping_target | C09G5 | ||||
| Type_of_mutation | Substitution | c | g | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Laboratory | CB | ||||
| Status | Live | ||||
| Affects (2) | |||||
| Genetics | Gene_class | unc | |||
| Interpolated_map_position | II | 3.12413 | |||
| Reference | WBPaper00013670 | ||||
| Remark | alt_det = c to g mut_det = S255Ochre | Person_evidence | WBPerson10095 | ||
| Curator_confirmed | WBPerson51134 | ||||
| Variation information submitted by WBPerson10095 on 2022-02-17_14:57:53 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
| Method | Substitution_allele |
