WormBase Tree Display for Variation: WBVar00143613
expand all nodes | collapse all nodes | view schema
WBVar00143613 | Evidence | Paper_evidence | WBPaper00013670 | ||
---|---|---|---|---|---|
Person_evidence | WBPerson10095 | ||||
Name | Public_name | e933 | |||
Other_name | CE35827:p.Ser255Ter | ||||
C09G5.2a.1:c.797+2282G>C | |||||
C09G5.6.1:c.764C>G | |||||
HGVSg | CHROMOSOME_II:g.10709868C>G | ||||
Sequence_details | SMap | S_parent | Sequence | C09G5 | |
Flanking_sequences | cacctcgtcaaccttctggcggatacgatt | agatgggcagactccaccgtcatcgcctag | |||
Mapping_target | C09G5 | ||||
Type_of_mutation | Substitution | c | g | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin (3) | |||||
Affects | Gene | WBGene00007488 | |||
WBGene00000251 | |||||
Transcript | C09G5.2a.1 | VEP_consequence | intron_variant | ||
VEP_impact | MODIFIER | ||||
HGVSc | C09G5.2a.1:c.797+2282G>C | ||||
Intron_number | 6/10 | ||||
C09G5.6.1 | VEP_consequence | stop_gained | |||
VEP_impact | HIGH | ||||
HGVSc | C09G5.6.1:c.764C>G | ||||
HGVSp | CE35827:p.Ser255Ter | ||||
cDNA_position | 818 | ||||
CDS_position | 764 | ||||
Protein_position | 255 | ||||
Exon_number | 4/7 | ||||
Codon_change | tCa/tGa | ||||
Amino_acid_change | S/* | ||||
Genetics (2) | |||||
Reference | WBPaper00013670 | ||||
Remark | alt_det = c to g mut_det = S255Ochre | Person_evidence | WBPerson10095 | ||
Curator_confirmed | WBPerson51134 | ||||
Variation information submitted by WBPerson10095 on 2022-02-17_14:57:53 via the Allele submission form. | Curator_confirmed | WBPerson51134 | |||
Method | Substitution_allele |