WormBase Tree Display for Variation: WBVar00143615
expand all nodes | collapse all nodes | view schema
WBVar00143615 | Evidence | Person_evidence | WBPerson10095 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e935 | ||||||
Other_name | CE35827:p.Gly500Glu | |||||||
C09G5.2a.1:c.797+1547C>T | ||||||||
C09G5.6.1:c.1499G>A | ||||||||
HGVSg | CHROMOSOME_II:g.10710603G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C09G5 | ||||
Flanking_sequences | agtcaattccaggacctccaggtcagccag | agtaatgggtgtaccaggaagagacggaga | ||||||
Mapping_target | C09G5 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004369 | |||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00007488 | ||||||
WBGene00000251 | ||||||||
Transcript | C09G5.2a.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | C09G5.2a.1:c.797+1547C>T | |||||||
Intron_number | 6/10 | |||||||
C09G5.6.1 (12) | ||||||||
Genetics (2) | ||||||||
Description | Phenotype | WBPhenotype:0000025 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Weaker allele than e769. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | alt_det = g to a mut_det = G500E | Person_evidence | WBPerson10095 | |||||
Curator_confirmed | WBPerson51134 | |||||||
Variation information submitted by WBPerson10095 on 2022-02-17_14:46:48 via the Allele submission form. | Curator_confirmed | WBPerson51134 | ||||||
Method | Substitution_allele |