WormBase Tree Display for Variation: WBVar00143671
expand all nodes | collapse all nodes | view schema
WBVar00143671 | Evidence | Person_evidence | WBPerson201 | ||
---|---|---|---|---|---|
Name | Public_name | e998 | |||
Other_name (24) | |||||
HGVSg | CHROMOSOME_II:g.14657379C>T | ||||
Sequence_details | SMap | S_parent | Sequence | ZC101 | |
Flanking_sequences | CGGAAGAGGTCCATTTTCCTCTCGGAATCC | CACCTGATGCGTGCCGGAGTGTCCGAGTGC | |||
Mapping_target | ZC101 | ||||
Type_of_mutation | Substitution | C | T | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004221 | ||||
WBStrain00005866 | |||||
Laboratory | CB | ||||
VC | |||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006787 | |||
Transcript (13) | |||||
Interactor | WBInteraction000521944 | ||||
WBInteraction000538515 | |||||
WBInteraction000538524 | |||||
Isolation | Mutagen | EMS | |||
Genetics | Mapping_data | In_2_point | 934 | ||
Description (2) | |||||
Reference | WBPaper00032413 | ||||
WBPaper00005809 | |||||
WBPaper00014939 | |||||
WBPaper00014555 | |||||
WBPaper00002086 | |||||
WBPaper00025869 | |||||
WBPaper00036200 | |||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |