WormBase Tree Display for Variation: WBVar00143671
expand all nodes | collapse all nodes | view schema
WBVar00143671 | Evidence | Person_evidence | WBPerson201 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e998 | |||||||
Other_name (24) | |||||||||
HGVSg | CHROMOSOME_II:g.14657379C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC101 | |||||
Flanking_sequences | CGGAAGAGGTCCATTTTCCTCTCGGAATCC | CACCTGATGCGTGCCGGAGTGTCCGAGTGC | |||||||
Mapping_target | ZC101 | ||||||||
Type_of_mutation | Substitution | C | T | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004221 | ||||||||
WBStrain00005866 | |||||||||
Laboratory | CB | ||||||||
VC | |||||||||
Analysis | Million_Mutation_Pilot_Project | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006787 | |||||||
Transcript (13) | |||||||||
Interactor | WBInteraction000521944 | ||||||||
WBInteraction000538515 | |||||||||
WBInteraction000538524 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Mapping_data | In_2_point | 934 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Person_evidence | WBPerson201 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are partially egg-laying defective. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are thin. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Several previously described class I unc-52 alleles also showed significant increases in the frequency of DTC migration defects of weak unc-5 alleles. These include unc-52(e669), unc-52(e998), and unc-52(e1421) (Table 1)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"All class I unc-52 alleles (except e444) strongly enhanced the penetrance of DTC migration defects of a null allele of unc-5 (Table 1)." | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | unc-5(e152) | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(e53) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000349 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are limp. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000473 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Stronger phenotype than e444. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000553 | Paper_evidence | WBPaper00002086 | |||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000818 | Paper_evidence | WBPaper00002086 | |||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000868 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are paralysed (except for head region). | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_not_observed (3) | |||||||||
Reference | WBPaper00032413 | ||||||||
WBPaper00005809 | |||||||||
WBPaper00014939 | |||||||||
WBPaper00014555 | |||||||||
WBPaper00002086 | |||||||||
WBPaper00025869 | |||||||||
WBPaper00036200 | |||||||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||||
Method | KO_consortium_allele |