WormBase Tree Display for Variation: WBVar00144001
expand all nodes | collapse all nodes | view schema
WBVar00144001 | Evidence | Paper_evidence | WBPaper00031068 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1430 | |||||||
Other_name | CE25115:p.Arg157Ter | ||||||||
T19B4.7.1:c.469C>T | |||||||||
HGVSg | CHROMOSOME_I:g.5687164G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T19B4 | |||||
Flanking_sequences | ttggcaaagtttgaactgcaagcgattgat | gaactctagcaaaagggcagccaactgcgt | |||||||
Mapping_target | T19B4 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00031068 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004390 | ||||||||
WBStrain00022025 | |||||||||
WBStrain00022040 | |||||||||
WBStrain00022045 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006776 | |||||||
Transcript | T19B4.7.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T19B4.7.1:c.469C>T | ||||||||
HGVSp | CE25115:p.Arg157Ter | ||||||||
cDNA_position | 532 | ||||||||
CDS_position | 469 | ||||||||
Protein_position | 157 | ||||||||
Exon_number | 5/19 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor | WBInteraction000500178 | ||||||||
WBInteraction000500179 | |||||||||
WBInteraction000500930 | |||||||||
WBInteraction000500940 | |||||||||
WBInteraction000501812 | |||||||||
WBInteraction000502342 | |||||||||
WBInteraction000518366 | |||||||||
WBInteraction000518370 | |||||||||
WBInteraction000518559 | |||||||||
WBInteraction000524010 | |||||||||
WBInteraction000524012 | |||||||||
Genetics | Interpolated_map_position | I | 0.317602 | ||||||
Mapping_data | In_multi_point | 244 | |||||||
290 | |||||||||
In_pos_neg_data | 4018 | ||||||||
4028 | |||||||||
4032 | |||||||||
4038 | |||||||||
4045 | |||||||||
4052 | |||||||||
4059 | |||||||||
4066 | |||||||||
Description | Phenotype | WBPhenotype:0000104 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Overall, in unc-40(e1430) mutants, 29% of QL cells showed no clear direction of polarization and 4% were misdirected towards the anterior (Fig. 3L). Similarly, 38% of QR cells were unpolarized and 14% of QR cells were incorrectly polarized towards the posterior (Fig. 3M)." | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0030010 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000137 | Paper_evidence | WBPaper00040419 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Introduction of the unc-40(e1430) allele to the mig-21(u787) mutant background resulted in a relative loss of endogenous mab-5 mRNA expression in QL cells, resembling normal (low) QR mab-5 expression (Figure 7C). | Paper_evidence | WBPaper00040419 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00040419 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00040419 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | heIs63[Pwrt-2::gfp-ph; Pwrt-2::h2b-gfp] | Paper_evidence | WBPaper00040419 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000229 | Paper_evidence | WBPaper00044134 | |||||||
Curator_confirmed | WBPerson1659 | ||||||||
Remark | Table 3 | Paper_evidence | WBPaper00044134 | ||||||
Curator_confirmed | WBPerson1659 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00036484 | |||||||
WBPaper00035146 | |||||||||
WBPaper00040147 | |||||||||
WBPaper00031828 | |||||||||
WBPaper00040041 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | AVM axons sometimes fail to grow ventrally. | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
AVM axons migrate anteriorly and HSN axons migrate in a number of aberrant patterns, this defect is more pronounced for HSN axons. | Paper_evidence | WBPaper00035146 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Mutants exhibited a weaker effect on dorsally directed VD axons than unc-6 and unc-5 animals. | Paper_evidence | WBPaper00040147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals had strong axon guidance defects. | Paper_evidence | WBPaper00040147 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals exhibit dorsal guidance defects. | Paper_evidence | WBPaper00031828 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals exhibit AVM ventral axon guidance defects. These defects can be rescued by exogenous acetylcholine. DD and VD axon guidance defects were not suppressed by acetylcholine. | Paper_evidence | WBPaper00040041 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00036484 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004765 | Paper_evidence | WBPaper00040041 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
WBPaper00035146 | |||||||||
WBPaper00040041 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00035146 | ||||||
WBPaper00040147 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00040147 | ||||||
WBPaper00040041 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00040041 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00040419 | |||||||
WBPaper00004437 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | unc-40(e1430) mutants exhibit a failure of QL and QR to properly migrate. | Paper_evidence | WBPaper00040419 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"As predicted, we found that in unc-40 and dpy-19 mutants, the QL descendants sometimes migrated anteriorly and the QR descendants sometimes remained in the posterior (Fig. 7 and Hedgecock et al., 1990)." | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00040419 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00040419 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00033081 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | unc-40 mutants exhibit a vulval morphology defect: vulF is misshapen | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00003665 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 84% of animals showed wild-type ASI amphid neuron outgrowth. Mutants also showed premature axon termination (10%) or lateral axon outgrowth (6%). | Paper_evidence | WBPaper00003665 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003665 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00003665 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | kyIs128[str-3::GFP] | Paper_evidence | WBPaper00003665 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001848 | Paper_evidence | WBPaper00033081 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants lack a dorsal vulval lumen | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | IcEx982.11.2 (TAT-2::GFP) | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00033081 | ||||||
WBPaper00035146 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Polarity is normal in all mutants | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Mutants do not alter the asymmetric localization of UNC-40 | Paper_evidence | WBPaper00035146 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | kuIs47 [AJM-1::GFP] | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000220 | Paper_evidence | WBPaper00033081 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | zmp-1 and lin-3 markers are expressed in the correct cell at the expected time in over 90% of the mutants | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | syIs107[lin-3(delta-pes-10)::GFP], syIs49[zmp- 1::GFP] | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00031828 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00031828 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00035146 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | UNC-40::GFP is ventrally localized as in wild type animals. | Paper_evidence | WBPaper00035146 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (13) | |||||||||
Method | Substitution_allele |