WormBase Tree Display for Variation: WBVar00144038
expand all nodes | collapse all nodes | view schema
WBVar00144038 | Evidence | Paper_evidence | WBPaper00026986 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1489 | |||||||
Other_name | T07G12.12a.1:c.775G>A | ||||||||
CE36715:p.Gly259Arg | |||||||||
HGVSg | CHROMOSOME_IV:g.10563247G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T07G12 | |||||
Flanking_sequences | aatcgagcaattgcgtggaagaggaaatat | gaaaacttcgtcttatcgatcacgcattgg | |||||||
Mapping_target | T07G12 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026986 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00001867 | |||||||
Transcript | T07G12.12a.1 (12) | ||||||||
Genetics | Interpolated_map_position | IV | 4.63927 | ||||||
Mapping_data | In_2_point | 317 | |||||||
In_multi_point (12) | |||||||||
In_pos_neg_data (5) | |||||||||
Description | Phenotype | WBPhenotype:0000583 | Paper_evidence | WBPaper00001077 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals segregate 5% XXX (Dumpy) progeny. | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000742 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit reduced recombination (9%) compared to wild type. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000863 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males exhibit 8.8% wild type fertility. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00001077 | |||||||
WBPaper00000565 | |||||||||
WBPaper00000179 | |||||||||
WBPaper00048917 | |||||||||
Person_evidence | WBPerson136 | ||||||||
WBPerson261 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPerson721 | |||||||||
Remark | Little or no autosomal missegregation. | Person_evidence | WBPerson136 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Male self-progeny make up 30.3% population as measured from 8 broods, 895 total animals. | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Animals segregate 36.7% males compared to 0.3% segregated by wild type animals. | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Self-progeny 37% XO male, 6% 3X herm, 38% nullo-X ova as a result of reductional meiotic nondisjunction X chromosome recombination specifically reduced 90% except at left end (increased). Easy to score (ES3) as progeny. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Person_evidence | WBPerson136 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
31% | Paper_evidence | WBPaper00001077 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Range | 39 | 39 | Person_evidence | WBPerson136 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson136 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001583 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals segregate a small percentage (6.4%) of short animals shown to be 3X hermaphrodites (wild type segregates 0.04% 3X herm.). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0.8% eggs never hatch, yet are refractile, similar in percent to those from wild type animals. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00001077 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals produce 4% dead embryos and L1 (n=1597), not unlike wild type, which produce 2% dead L1 (n=1755). | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000143 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | UV sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 1Jm 10X-2/sec. Irradiated animals were protected from light. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have an average brood size of 30237 s.d. (6 broods counted), wild type has average brood size 33034 s.d. (8 broods counted). | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000276 | Paper_evidence | WBPaper00000565 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | X-ray sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 470 r/min. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals are indistinguishable from wild type in terms of behavior. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Both hermaphrodites and males are indistinguishable from wild type in terms of superficial anatomy. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00001077 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Average brood size 254 38 (n=1597) | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001631 | Paper_evidence | WBPaper00000179 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The sex ratio of cross progeny sired by him males does not significantly differ from 1:1. | Paper_evidence | WBPaper00000179 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000179 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002140 | Paper_evidence | WBPaper00032050 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males responded to ascr#3, an ascaroside, in male attraction assays. | Paper_evidence | WBPaper00032050 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (29) | |||||||||
Remark | Allele incorrectly cited as e1389 | Paper_evidence | WBPaper00003393 | ||||||
Allele incorrectly cited as e2489 | Paper_evidence | WBPaper00003294 | |||||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||||
Method | Substitution_allele |