WormBase Tree Display for Variation: WBVar00144038

WBVar00144038 Evidence: Paper_evidence: WBPaper00026986
  Name: Public_name: e1489
    Other_name: T07G12.12a.1:c.775G>A
      CE36715:p.Gly259Arg
    HGVSg: CHROMOSOME_IV:g.10563247G>A
  Sequence_details: SMap: S_parent: Sequence: T07G12
    Flanking_sequences: aatcgagcaattgcgtggaagaggaaatat gaaaacttcgtcttatcgatcacgcattgg
    Mapping_target: T07G12
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00026986
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain (127)
    Laboratory: CB
      NFB
      OH
      CHB
    Status: Live
  Affects: Gene: WBGene00001867
    Transcript: T07G12.12a.1 (12)
  Genetics: Interpolated_map_position: IV 4.63927
    Mapping_data: In_2_point: 317
      In_multi_point (12)
      In_pos_neg_data (5)
  Description: Phenotype: WBPhenotype:0000583 Paper_evidence: WBPaper00001077
        Curator_confirmed: WBPerson712
        Remark: Animals segregate 5% XXX (Dumpy) progeny. Paper_evidence: WBPaper00001077
            Curator_confirmed: WBPerson712
        Penetrance: Low: Paper_evidence: WBPaper00001077
              Curator_confirmed: WBPerson712
      WBPhenotype:0000742 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit reduced recombination (9%) compared to wild type. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00000179
                Curator_confirmed: WBPerson712
      WBPhenotype:0000863 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Males exhibit 8.8% wild type fertility. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000056 PATO:0000460 Paper_evidence: WBPaper00000179
                Curator_confirmed: WBPerson712
      WBPhenotype:0001175 Paper_evidence: WBPaper00001077
          WBPaper00000565
          WBPaper00000179
          WBPaper00048917
        Person_evidence: WBPerson136
          WBPerson261
        Curator_confirmed: WBPerson48
          WBPerson712
          WBPerson721
        Remark: Little or no autosomal missegregation. Person_evidence: WBPerson136
            Curator_confirmed: WBPerson48
          Male self-progeny make up 30.3% population as measured from 8 broods, 895 total animals. Paper_evidence: WBPaper00000565
            Curator_confirmed: WBPerson712
          Animals segregate 36.7% males compared to 0.3% segregated by wild type animals. Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
          Self-progeny 37% XO male, 6% 3X herm, 38% nullo-X ova as a result of reductional meiotic nondisjunction X chromosome recombination specifically reduced 90% except at left end (increased). Easy to score (ES3) as progeny. Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Person_evidence: WBPerson136
              Curator_confirmed: WBPerson48
            31% Paper_evidence: WBPaper00001077
              Curator_confirmed: WBPerson712
          Range: 39 39 Person_evidence: WBPerson136
                Curator_confirmed: WBPerson48
        Recessive: Person_evidence: WBPerson136
          Curator_confirmed: WBPerson48
        Ease_of_scoring: ES3_Easy_to_score: Person_evidence: WBPerson261
            Curator_confirmed: WBPerson712
      WBPhenotype:0001583 Paper_evidence: WBPaper00000179
        Curator_confirmed: WBPerson712
        Remark: Animals segregate a small percentage (6.4%) of short animals shown to be 3X hermaphrodites (wild type segregates 0.04% 3X herm.). Paper_evidence: WBPaper00000179
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000057 PATO:0000460 Paper_evidence: WBPaper00000179
                Curator_confirmed: WBPerson712
    Phenotype_not_observed (10)
  Reference (29)
  Remark: Allele incorrectly cited as e1389 Paper_evidence: WBPaper00003393
    Allele incorrectly cited as e2489 Paper_evidence: WBPaper00003294
    Variation stub/paper connection generated from the May 2021 NN VFP dataset.
    Created by WBPerson51134 from the NN_VFP_triage_pipeline
  Method: Substitution_allele