WormBase Tree Display for Variation: WBVar00144198
expand all nodes | collapse all nodes | view schema
WBVar00144198 | Evidence | Paper_evidence | WBPaper00000738 | |||
---|---|---|---|---|---|---|
Name | Public_name | e1662 | ||||
Other_name (2) | ||||||
HGVSg | CHROMOSOME_I:g.14856385_14856386del | |||||
Sequence_details | SMap | S_parent | Sequence | F32A7 | ||
Flanking_sequences | acattccatcatcttattaatttcaggagg | ctcgccaacttgaacctccagaagtacaag | ||||
Mapping_target | F32A7 | |||||
Type_of_mutation | Insertion | |||||
Deletion | aa | Paper_evidence | WBPaper00000738 | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Laboratory | CB | |||||
Status | Live | |||||
Affects | Gene | WBGene00006789 | ||||
Transcript | F11C3.3.1 | VEP_consequence | frameshift_variant | |||
VEP_impact | HIGH | |||||
HGVSc | F11C3.3.1:c.5687_5688del | |||||
HGVSp | CE09349:p.Glu1896AlafsTer17 | |||||
cDNA_position | 5719-5720 | |||||
CDS_position | 5687-5688 | |||||
Protein_position | 1896 | |||||
Exon_number | 10/11 | |||||
Codon_change | gAA/g | |||||
Amino_acid_change | E/X | |||||
Genetics | Interpolated_map_position | I | 27.9599 | |||
Reference | WBPaper00000738 | |||||
Remark | The e1662 insertion consists of a 288 base pair segment that is a displaced duplication, in inverted orientation, of a nearby region of unc-54. | Paper_evidence | WBPaper00000738 | |||
Method | Deletion_and_insertion_allele |