WormBase Tree Display for Variation: WBVar00144752
expand all nodes | collapse all nodes | view schema
WBVar00144752 | Evidence | Paper_evidence | WBPaper00029148 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e2333 | ||||||
Other_name (2) | ||||||||
HGVSg | CHROMOSOME_IV:g.14436848delinsT | |||||||
Sequence_details | SMap | S_parent | Sequence | LLC1 | ||||
Flanking_sequences | aaaatcgtcagcaatacaaaatcgaagtgt | gaagatcgtaaaatggctcgagaccacct | ||||||
Mapping_target | LLC1 | |||||||
Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00029148 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004559 | |||||||
WBStrain00040924 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006606 | ||||||
Transcript | LLC1.1a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | LLC1.1a.1:c.1778delinsA | |||||||
HGVSp | CE16260:p.Trp593Ter | |||||||
cDNA_position | 1812-1813 | |||||||
CDS_position | 1778-1779 | |||||||
Protein_position | 593 | |||||||
Exon_number | 9/10 | |||||||
Codon_change | tGG/tAG | |||||||
Amino_acid_change | W/* | |||||||
Genetics | Interpolated_map_position | IV | 11.9592 | |||||
Description | Phenotype | WBPhenotype:0000673 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | brood size increased | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001025 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | XX anatomically WT | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00013706 | |||||||
Remark | e2333 is either a W(593) to Amber or W(593) to Ochre | Paper_evidence | WBPaper00029148 | |||||
Person_evidence | WBPerson1742 | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006606 Nonsense | ||||||||
Method | Substitution_allele |