WormBase Tree Display for Variation: WBVar00144812
expand all nodes | collapse all nodes | view schema
WBVar00144812 | Evidence | Paper_evidence | WBPaper00031616 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e2410 | |||||||
Other_name | T27A1.6.1:c.407+1G>A | ||||||||
HGVSg | CHROMOSOME_II:g.519315G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T27A1 | |||||
Flanking_sequences | cctagatgtagtcccagtggactccaaaag | taactttttcccttcaaaactttttttcta | |||||||
Mapping_target | T27A1 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00050590 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004574 | ||||||||
WBStrain00047150 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003106 | |||||||
Transcript | T27A1.6.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T27A1.6.1:c.407+1G>A | ||||||||
Intron_number | 5/10 | ||||||||
Interactor | WBInteraction000586280 | ||||||||
Genetics | Interpolated_map_position | II | -15.5963 | ||||||
Description | Phenotype | WBPhenotype:0000070 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The male tail morphogenesis was grossly abnormal. | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005741 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0048808 | PATO:0000460 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-8(e1489) | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00031616 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Only very weak expression of unc-129GFP was observed in neurons at the anterior and posterior and very few commissures could be observed exiting the ventral cord in mab-9 mutants. | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0010468 | PATO:0000460 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | evIs82b [unc-129::GFP] | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00031616 | |||||||
WBPaper00037678 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson557 | |||||||||
Remark | Animals exhibited defects in axon guidance of dorsally-directed commissures. Defective axons stalled at specific points along their path and then extended laterally to cross a number of commissures. | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
mab-9(e2410) animals display axon guidance defects. VD motor neurons extend circumferential commissures that are sometimes misguided. Misguided commissures often stall before reaching the dorsal side and then cross adjacent commissures. | Paper_evidence | WBPaper00037678 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005334 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000022 | PATO:0000460 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0007411 | PATO:0000460 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
GO:0030424 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | unc-25::GFP or unc-53::GFP or unc-129::GFP | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
unc-25::gfp | Paper_evidence | WBPaper00037678 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000432 | Paper_evidence | WBPaper00031616 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No spicules were evident. | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005741 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | him-8(e1489) | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00031616 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were slightly backwards Unc. | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001672 | Paper_evidence | WBPaper00031616 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | On average 1.5 expressing commisures were misguided per animal, as observed by unc-25::GFP expression. In addition, 100% of animals had at least 1 misguided axon, as observed by unc-53::GFP expression. Whereas, no defects were observed in wild-type animals expressing either GFP construct. | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005278 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005274 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005334 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000022 | PATO:0000460 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0007411 | PATO:0000460 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
GO:0030424 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | unc-25::GFP or unc-53::GFP or unc-129::GFP | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001140 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals did not show any defects in neuronal cell body positioning. | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003679 | PATO:0000460 | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0051674 | PATO:0000460 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | unc-25::GFP or unc-53::GFP or unc-129::GFP | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031616 | ||||||||
WBPaper00050590 | |||||||||
WBPaper00037678 | |||||||||
Method | Substitution_allele |