WormBase Tree Display for Variation: WBVar00145227
expand all nodes | collapse all nodes | view schema
WBVar00145227 | Evidence | Paper_evidence | WBPaper00001105 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ev424 | |||||||
Other_name | C01G10.11c.1:c.59_60dup | ||||||||
CE39211:p.Asp112SerfsTer21 | |||||||||
CE39210:p.Asp112SerfsTer21 | |||||||||
C01G10.11f.1:c.332_333dup | |||||||||
CE45264:p.Asp21SerfsTer21 | |||||||||
C01G10.11b.1:c.332_333dup | |||||||||
C01G10.11a.1:c.332_333dup | |||||||||
CE45243:p.Asp112SerfsTer21 | |||||||||
HGVSg | CHROMOSOME_V:g.15074825_15074826dup | ||||||||
Sequence_details | SMap | S_parent | Sequence | C01G10 | |||||
Flanking_sequences | accggaaactttggaaacattcaacctctc | gactttggaacctcttcgatatgtaaaaag | |||||||
Mapping_target | C01G10 | ||||||||
Type_of_mutation | Insertion | tc | Paper_evidence | WBPaper00002751 | |||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00029116 | ||||||||
Laboratory | NW | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00305248 | |||||||
WBGene00006808 | |||||||||
WBGene00305285 | |||||||||
WBGene00305247 | |||||||||
Transcript | C01G10.21 | ||||||||
C01G10.11f.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G10.11f.1:c.332_333dup | ||||||||
HGVSp | CE45243:p.Asp112SerfsTer21 | ||||||||
cDNA_position | 457-458 | ||||||||
CDS_position | 333-334 | ||||||||
Protein_position | 111-112 | ||||||||
Exon_number | 5/12 | ||||||||
Codon_change | -/TC | ||||||||
Amino_acid_change | -/X | ||||||||
C01G10.11b.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G10.11b.1:c.332_333dup | ||||||||
HGVSp | CE39211:p.Asp112SerfsTer21 | ||||||||
cDNA_position | 344-345 | ||||||||
CDS_position | 333-334 | ||||||||
Protein_position | 111-112 | ||||||||
Exon_number | 5/10 | ||||||||
Codon_change | -/TC | ||||||||
Amino_acid_change | -/X | ||||||||
C01G10.11a.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G10.11a.1:c.332_333dup | ||||||||
HGVSp | CE39210:p.Asp112SerfsTer21 | ||||||||
cDNA_position | 341-342 | ||||||||
CDS_position | 333-334 | ||||||||
Protein_position | 111-112 | ||||||||
Exon_number | 5/11 | ||||||||
Codon_change | -/TC | ||||||||
Amino_acid_change | -/X | ||||||||
C25D7.19 | |||||||||
C01G10.20 | |||||||||
C01G10.11c.1 | VEP_consequence | frameshift_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G10.11c.1:c.59_60dup | ||||||||
HGVSp | CE45264:p.Asp21SerfsTer21 | ||||||||
cDNA_position | 60-61 | ||||||||
CDS_position | 60-61 | ||||||||
Protein_position | 20-21 | ||||||||
Exon_number | 2/7 | ||||||||
Codon_change | -/TC | ||||||||
Amino_acid_change | -/X | ||||||||
Genetics | Interpolated_map_position | V | 7.31636 | ||||||
Description | Phenotype | WBPhenotype:0000181 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons are posteriorly misdirected and never reach the nerve ring | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 1 | 1 | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN axons show ventral blocks (failure to extend ventrally from their cell bodies to the ventral cord) and anterior blocks (axons enter the ventral cord normally but fail to complete the anterior growth towards the nerve ring) | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | 7 percent of mutants have ventral blocks and 92 percent have anterior blocks | Paper_evidence | WBPaper00001105 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Reference | WBPaper00001105 | ||||||||
WBPaper00002751 | |||||||||
Method | Insertion_allele |