WormBase Tree Display for Variation: WBVar00145269
expand all nodes | collapse all nodes | view schema
WBVar00145269 | Evidence | Paper_evidence | WBPaper00003865 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ev658 | |||||||
HGVSg | CHROMOSOME_IV:g.10576008_10577842del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C43F9 | |||||
Flanking_sequences | ttcagttcgtcctgtgataagcatgccaat | tggtacatgatgagagcgatattgatgacg | |||||||
Mapping_target | C43F9 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005372 | ||||||||
WBStrain00005375 | |||||||||
WBStrain00005671 | |||||||||
WBStrain00029134 | |||||||||
WBStrain00029135 | |||||||||
Laboratory | NW | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00200531 | |||||||
WBGene00001163 | |||||||||
Transcript | C43F9.18 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
C43F9.8.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-592 | ||||||||
CDS_position | ?-553 | ||||||||
Protein_position | ?-185 | ||||||||
Intron_number | 2-4/6 | ||||||||
Exon_number | 1-5/7 | ||||||||
Interactor | WBInteraction000503639 | ||||||||
WBInteraction000519472 | |||||||||
Isolation | Transposon_excision | ||||||||
Genetics | Interpolated_map_position | IV | 4.64005 | ||||||
Description | Phenotype | WBPhenotype:0000195 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed defects in DTC migration along the ventral body wall muscle between the hyp7 hypodermal syncytium (phase 1) and during the migration along the dorsal body wall muscle (phase 3), but not while crossing hyp7 (phase 2), as visualized by lag-2::GFP expression. | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002045 | Paper_evidence | WBPaper00040629 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Germ-cell corpse quantification in mutants show a strong germ-cell death defect, similar to vab-1/EphR-null mutants. | Paper_evidence | WBPaper00040629 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040629 | ||||||||
WBPaper00031951 | |||||||||
Remark | Flanking sequences are 30 bp to the left of -380 bp from ATG and 30 bp to the right of bp 1454 of C43F9.8 | Curator_confirmed | WBPerson1845 | ||||||
ev658 is a deletion of 1835 bp (Fig.1B), starting 380 bp upstream of the translation initiation codon and including codons for the first 182 residues of the EFN-2 protein | Paper_evidence | WBPaper00003865 | |||||||
Method | Deletion_allele |