WormBase Tree Display for Variation: WBVar00145269

WBVar00145269 Evidence: Paper_evidence: WBPaper00003865
  Name: Public_name: ev658
    HGVSg: CHROMOSOME_IV:g.10576008_10577842del
  Sequence_details: SMap: S_parent: Sequence: C43F9
    Flanking_sequences: ttcagttcgtcctgtgataagcatgccaat tggtacatgatgagagcgatattgatgacg
    Mapping_target: C43F9
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00005372
      WBStrain00005375
      WBStrain00005671
      WBStrain00029134
      WBStrain00029135
    Laboratory: NW
    Status: Live
  Affects: Gene: WBGene00200531
      WBGene00001163
    Transcript: C43F9.18 VEP_consequence: transcript_ablation
        VEP_impact: HIGH
        Exon_number: 1/1
      C43F9.8.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-592
        CDS_position: ?-553
        Protein_position: ?-185
        Intron_number: 2-4/6
        Exon_number: 1-5/7
    Interactor: WBInteraction000503639
      WBInteraction000519472
  Isolation: Transposon_excision
  Genetics: Interpolated_map_position: IV 4.64005
  Description: Phenotype: WBPhenotype:0000195 Paper_evidence: WBPaper00031951
        Curator_confirmed: WBPerson712
        Remark: Animals showed defects in DTC migration along the ventral body wall muscle between the hyp7 hypodermal syncytium (phase 1) and during the migration along the dorsal body wall muscle (phase 3), but not while crossing hyp7 (phase 2), as visualized by lag-2::GFP expression. Paper_evidence: WBPaper00031951
            Curator_confirmed: WBPerson712
        Penetrance: Incomplete: Paper_evidence: WBPaper00031951
              Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006865 PATO:0000460 Paper_evidence: WBPaper00031951
                Curator_confirmed: WBPerson712
          Life_stage: WBls:0000035 PATO:0000460 Paper_evidence: WBPaper00031951
                Curator_confirmed: WBPerson712
            WBls:0000038 PATO:0000460 Paper_evidence: WBPaper00031951
                Curator_confirmed: WBPerson712
            WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00031951
                Curator_confirmed: WBPerson712
          GO_term: GO:0016477 PATO:0000460 Paper_evidence: WBPaper00031951
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were reared on NA22 bacteria instead of OP50. Paper_evidence: WBPaper00031951
              Curator_confirmed: WBPerson712
          Temperature: 20 Paper_evidence: WBPaper00031951
              Curator_confirmed: WBPerson712
      WBPhenotype:0002045 Paper_evidence: WBPaper00040629
        Curator_confirmed: WBPerson712
        Remark: Germ-cell corpse quantification in mutants show a strong germ-cell death defect, similar to vab-1/EphR-null mutants. Paper_evidence: WBPaper00040629
            Curator_confirmed: WBPerson712
  Reference: WBPaper00040629
    WBPaper00031951
  Remark: Flanking sequences are 30 bp to the left of -380 bp from ATG and 30 bp to the right of bp 1454 of C43F9.8 Curator_confirmed: WBPerson1845
    ev658 is a deletion of 1835 bp (Fig.1B), starting 380 bp upstream of the translation initiation codon and including codons for the first 182 residues of the EFN-2 protein Paper_evidence: WBPaper00003865
  Method: Deletion_allele