WormBase Tree Display for Variation: WBVar00145465
expand all nodes | collapse all nodes | view schema
| WBVar00145465 | Name | Public_name | gk9 | ||||
|---|---|---|---|---|---|---|---|
| Other_name (16) | |||||||
| HGVSg | CHROMOSOME_IV:g.6163313_6165599delinsGTGTAAAATGTTGGGAATACTCAATTTCCTGCGGAAACAGACGCTTTTTTTCAATTATTTTGGGGGAGTTTTCGGGAATTATAATTTGGGGGTTAGTCGGAAAAGGTCATCGAATCAAAGTACTCAAA | ||||||
| Sequence_details | SMap | S_parent | Sequence | C11D2 | |||
| Flanking_sequences | gaggtcattcttagtgattgaggaaaacac | taatgtttcaaaattgtcatcgacagtcaa | |||||
| Mapping_target | C11D2 | ||||||
| Type_of_mutation | Insertion | gtgtaaaatgttgggaatactcaatttcctgcggaaacagacgctttttttcaattattttgggggagttttcgggaattataatttgggggttagtcggaaaaggtcatcgaatcaaagtactcaaa | |||||
| Deletion | |||||||
| PCR_product | GK9_external | ||||||
| GK9_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00035028 | ||||||
| WBStrain00035029 | |||||||
| WBStrain00035482 | |||||||
| WBStrain00040855 | |||||||
| WBStrain00040862 | |||||||
| WBStrain00040863 | |||||||
| WBStrain00040864 | |||||||
| WBStrain00040865 | |||||||
| Component_of_genotype | WBGenotype00000089 | ||||||
| WBGenotype00000090 | |||||||
| Laboratory | VC | ||||||
| Person | WBPerson427 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00171539 | |||||
| WBGene00049242 | |||||||
| WBGene00165476 | |||||||
| WBGene00047448 | |||||||
| WBGene00046897 | |||||||
| WBGene00174308 | |||||||
| WBGene00047278 | |||||||
| WBGene00006809 | |||||||
| Transcript (23) | |||||||
| Interactor | WBInteraction000501184 | ||||||
| WBInteraction000503537 | |||||||
| WBInteraction000586830 | |||||||
| WBInteraction000586831 | |||||||
| Genetics | Mapping_data | In_multi_point | 4509 | ||||
| Description | Phenotype (18) | ||||||
| Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | The single mutant displays normal locomotion. | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00031592 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00043908 | ||||||
| WBPaper00031592 | |||||||
| WBPaper00025465 | |||||||
| WBPaper00019702 | |||||||
| WBPaper00048388 | |||||||
| WBPaper00066271 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
