WormBase Tree Display for Variation: WBVar00145642
expand all nodes | collapse all nodes | view schema
WBVar00145642 | Name | Public_name | gk235 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | C08A9.1.1:c.54-167_228delinsATCTAA | ||||||||
HGVSg | CHROMOSOME_X:g.17093068_17093457delinsATCTAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | C08A9 | |||||
Flanking_sequences | gaaaatatctaggaaatactacttttaaaa | aatctaaaagaagcaattgctctccaacca | |||||||
Mapping_target | C08A9 | ||||||||
Type_of_mutation | Insertion | ATCTAA | |||||||
Deletion | |||||||||
PCR_product | gk235_external | ||||||||
gk235_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00000204 | ||||||||
WBStrain00035766 | |||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00015583 | |||||||
WBGene00004932 | |||||||||
Transcript | C08A9.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C08A9.1.1:c.54-167_228delinsATCTAA | ||||||||
cDNA_position | ?-243 | ||||||||
CDS_position | ?-228 | ||||||||
Protein_position | ?-76 | ||||||||
Intron_number | 2-3/6 | ||||||||
Exon_number | 3-4/7 | ||||||||
C08A9.3a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
Intron_number | 2/16 | ||||||||
Exon_number | 1-2/17 | ||||||||
Interactor | WBInteraction000542786 | ||||||||
WBInteraction000542787 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Mapping_data | In_multi_point | 4685 | ||||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00034661 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The sod-3(gk235) mutation resulted in increased induction of mRNA expression of the genes hsp-16.1, hsp-16.2, hsp-16.41, hsp-70, col-131, pgp-14, ain-1, apt-10, lin-10, cogc-4, wnk-1, and F02A9.4 in response to silver nanoparticle (AgNP) exposure, compared to wild type animals and as determined by qRT-PCR. Also, mtl-2 expression was absent (Figure 4 compared to Figure 3A). | Paper_evidence | WBPaper00034661 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00034661 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000591 | Paper_evidence | WBPaper00034661 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | sod-3(gk235) mutants exhibited a significant resistance to the toxic effects of silver nanoparticles on reproduction (Table 1) | Paper_evidence | WBPaper00034661 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00034661 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001014 | Paper_evidence | WBPaper00055320 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | This mutant is more resistant to enterotoxigenic Escherichia coli infection compared with N2 wild-type animals. | Paper_evidence | WBPaper00055320 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Animals grown on plates containing K88plus enterotoxigenic Escherichia coli (ETEC) strain JG280. | Paper_evidence | WBPaper00055320 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00031981 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006976 | PATO:0000460 | Paper_evidence | WBPaper00031981 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were grown under hypoxic (1% oxygen) conditions. | Paper_evidence | WBPaper00031981 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002125 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Exposure to only a selected coated silver nanoparticles (Ag NPs), PVP38, CIT7, and GA22 resulted in an enhanced level of growth inhibition compared to similarly treated N2; however, exposure to AgNO3, PVP8, and GA5 did not result in an enhanced response. | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00040519 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005290 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005293 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005294 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005295 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005296 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00003522 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002251 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Exposure to only a selected coated silver nanoparticles (Ag NPs), PVP38, CIT7, and GA22 resulted in an enhanced level of growth inhibition compared to similarly treated N2; however, exposure to AgNO3, PVP8, and GA5 did not result in an enhanced response. | Paper_evidence | WBPaper00040519 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Affected_by | Molecule | WBMol:00005288 | Paper_evidence | WBPaper00040519 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBMol:00005290 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBMol:00005293 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBMol:00005294 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBMol:00005295 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBMol:00005296 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBMol:00003522 | Paper_evidence | WBPaper00040519 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0002256 | Paper_evidence | WBPaper00044686 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Resistant to selenium induced movement defect. | Paper_evidence | WBPaper00044686 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Affected_by | Molecule | WBMol:00001915 | Paper_evidence | WBPaper00044686 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_not_observed | WBPhenotype:0001379 | Paper_evidence | WBPaper00044243 | ||||||
Curator_confirmed | WBPerson3701 | ||||||||
Remark | not more sensitive than wildtype to toxicity from exposure to water or pore water from sediments downstream of mountaintop mining sites (data not shown) | Paper_evidence | WBPaper00044243 | ||||||
Curator_confirmed | WBPerson3701 | ||||||||
Reference (6) | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |