WormBase Tree Display for Variation: WBVar00145734
expand all nodes | collapse all nodes | view schema
WBVar00145734 | Evidence | Paper_evidence | WBPaper00032243 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | gk327 | |||||||
Other_name | CE20184:p.Ser107_Ter156delextTer? | ||||||||
Y6B3B.10.1:c.318_467del | |||||||||
HGVSg | CHROMOSOME_I:g.13726938_13727137del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y6B3B | |||||
Flanking_sequences | aacgccgattgaactgcatatatcacttgt | tcgggtactttatgggcaaatcgggggtat | |||||||
Mapping_target | Y6B3B | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | gk327_external | ||||||||
gk327_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Deletion_verification | PCR with one primer internal to the deletion and one external confirms that no WT copy of the gene remains. | Person_evidence | WBPerson154 | ||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036034 | ||||||||
WBStrain00040672 | |||||||||
WBStrain00040673 | |||||||||
WBStrain00040674 | |||||||||
WBStrain00040675 | |||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006505 | |||||||
Transcript | Y6B3B.10.1 (11) | ||||||||
Interactor | WBInteraction000503803 | ||||||||
WBInteraction000535461 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The reduction in CED-4 mitochondrial colocalization and the accompanying increase in nuclear CED-4 signal upon irradiation was blocked entirely. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were scored for CED-4 localization at 36 hours postradiation. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | opIs219 | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 120-Gy-induced p53-mediated egl-1 (left) and ced-13 (right) up-regulation were not affected, as measured by reverse transcription polymerase chain reaction. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001172 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Age-related and radiation-induced germ cell apoptosis were nearly abolished compared to wild-type animals. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | L3-L4 larvae were assayed. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002541 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Radiation-induced germ cell apoptosis was inhibited. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | At least 20 animals were scored for germ cell apoptosis at 36 hours post-120 Gy and compared to WT-irradiated controls. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000648 | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency was not significantly different from wild type. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | For each strain, 16 males were mated with 16 late L4 stage unc-51 hermaphrodites for 24 hours and then scored for cross progeny (non-Dpy progeny) and self progeny. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Brood size was not significantly different from wild type. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000812 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The number of germ cell nuclei, 325.2 17.4 (n=10), was slightly less than wild type, 366.6 14.6 (n=10). | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The rate of germ cell corpse removal was unaffected. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | L3-L4 larvae were assayed. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000965 | Paper_evidence | WBPaper00032243 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0.1 0.4 (n=30) extra cells were counted in the anterior pharynx, similar to wild-type animals 0.05 0.22 (n=20). | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | L3-L4 larvae were assayed. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032243 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |