WormBase Tree Display for Variation: WBVar00146344
expand all nodes | collapse all nodes | view schema
WBVar00146344 | Evidence | Paper_evidence | WBPaper00003653 | ||||||
---|---|---|---|---|---|---|---|---|---|
WBPaper00042557 | |||||||||
Name | Public_name | gm122 | |||||||
Other_name | C01G6.8b.1:c.757C>T | ||||||||
C01G6.8a.1:c.835C>T | |||||||||
CE39126:p.Gln120Ter | |||||||||
C01G6.8c.1:c.358C>T | |||||||||
C01G6.8c.2:c.358C>T | |||||||||
CE24774:p.Gln253Ter | |||||||||
CE32563:p.Gln279Ter | |||||||||
HGVSg | CHROMOSOME_II:g.9298616G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C01G6 | |||||
Flanking_sequences | tataaagtttgcgaatcggattctaacaat | aaattgtttcgatttgcaagcacgattgtg | |||||||
Mapping_target | C01G6 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028753 | ||||||||
WBStrain00035434 | |||||||||
WBStrain00035438 | |||||||||
WBStrain00035439 | |||||||||
WBStrain00055653 | |||||||||
Laboratory | NG | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000289 | |||||||
Transcript | C01G6.8c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G6.8c.1:c.358C>T | ||||||||
HGVSp | CE39126:p.Gln120Ter | ||||||||
cDNA_position | 461 | ||||||||
CDS_position | 358 | ||||||||
Protein_position | 120 | ||||||||
Exon_number | 3/8 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C01G6.8b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G6.8b.1:c.757C>T | ||||||||
HGVSp | CE24774:p.Gln253Ter | ||||||||
cDNA_position | 789 | ||||||||
CDS_position | 757 | ||||||||
Protein_position | 253 | ||||||||
Exon_number | 5/10 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C01G6.8c.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G6.8c.2:c.358C>T | ||||||||
HGVSp | CE39126:p.Gln120Ter | ||||||||
cDNA_position | 363 | ||||||||
CDS_position | 358 | ||||||||
Protein_position | 120 | ||||||||
Exon_number | 2/7 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C01G6.8a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C01G6.8a.1:c.835C>T | ||||||||
HGVSp | CE32563:p.Gln279Ter | ||||||||
cDNA_position | 838 | ||||||||
CDS_position | 835 | ||||||||
Protein_position | 279 | ||||||||
Exon_number | 6/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (53) | |||||||||
Genetics | Interpolated_map_position | II | 1.10234 | ||||||
Description | Phenotype (16) | ||||||||
Phenotype_not_observed | WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No underinduced animals (worms with fewer than 22 vulval cells or fewer than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Wild-type animals or cam-1 mutants that carry mab-5::gfp expressed high levels of GFP in QL descendants but not in QR descendants (Figure 5; Table 2)." | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | muIs16 [mab-5::GFP] | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000406 | Paper_evidence | WBPaper00002978 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00006269 | |||||||
WBPaper00024898 | |||||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In cam-1(gm122) mutants, the QL descendants usually migrate to their proper positions (Fig. 4B)... To further investigate the role in Q cell migration of CAM-1 domains, we assessed the position of Q cell descendants in cam-1(sa692) and cam-1(ks52) (Fig. 5, Table 1). The final positions of QL descendants were similar in all three cam-1 mutants to wild type, suggesting that CAM-1 is not required for proper QL migration." | Paper_evidence | WBPaper00006269 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Table 1, Figure 6 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations (3) | |||||||||
Phenotype_assay | Treatment | "The percentage of QL cell descendants that were not located posterior to V4.p is presented. These represent QL descendants that have migrated anteriorly, rather than posteriorly. Because they occupy positions near each other, the data for SDQL and PVM were combined." | Paper_evidence | WBPaper00006269 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
From Table 1 legend: "Because QL descendants sometimes were misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p and misplaced posteriorly if its nucleus was posterior to V5.p. Because they occupy positions near each other, the data for SDQL and PVM were combined." | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00002978 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002193 | Paper_evidence | WBPaper00057191 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 0% n=54 | Paper_evidence | WBPaper00057191 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Image | WBPicture0000014918 | Paper_evidence | WBPaper00057191 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (11) | |||||||||
Method | Substitution_allele |