WormBase Tree Display for Variation: WBVar00146376
expand all nodes | collapse all nodes | view schema
WBVar00146376 | Evidence | Paper_evidence | WBPaper00031692 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | gt33 | ||||||
Other_name | T01C8.1c.1:c.144_591-16del | |||||||
T01C8.1a.1:c.330_777-16del | ||||||||
T01C8.1b.1:c.330_777-16del | ||||||||
HGVSg | CHROMOSOME_X:g.16800068_16800673del | |||||||
Sequence_details | SMap | S_parent | Sequence | T01C8 | ||||
Flanking_sequences | attttcagttggaatccatgagacaactca | aactttgttttgcaggttgtacgcaggtcc | ||||||
Mapping_target | T01C8 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034665 | |||||||
WBStrain00047359 | ||||||||
Laboratory | TG | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00020142 | ||||||
Transcript | T01C8.1b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T01C8.1b.1:c.330_777-16del | |||||||
cDNA_position | 330-? | |||||||
CDS_position | 330-? | |||||||
Protein_position | 110-? | |||||||
Intron_number | 3/10 | |||||||
Exon_number | 3/11 | |||||||
T01C8.1c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T01C8.1c.1:c.144_591-16del | |||||||
cDNA_position | 187-? | |||||||
CDS_position | 144-? | |||||||
Protein_position | 48-? | |||||||
Intron_number | 3/10 | |||||||
Exon_number | 3/11 | |||||||
T01C8.1a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T01C8.1a.1:c.330_777-16del | |||||||
cDNA_position | 332-? | |||||||
CDS_position | 330-? | |||||||
Protein_position | 110-? | |||||||
Intron_number | 4/11 | |||||||
Exon_number | 4/12 | |||||||
Interactor | WBInteraction000009106 | |||||||
WBInteraction000525129 | ||||||||
Isolation | Mutagen | UV-TMP | Paper_evidence | WBPaper00031692 | ||||
Genetics | Interpolated_map_position | X | 24.0615 | |||||
Description | Phenotype | WBPhenotype:0000462 | Paper_evidence | WBPaper00031692 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | aak-2 mutant worms showed hypersensitivity to paraquat | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Affected_by | Molecule | WBMol:00002747 | Paper_evidence | WBPaper00031692 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00045710 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The aak-2(gt33) mutation resulted in reduced fat content under fasting conditions, as determined by Oil Red O staining (Figure 4D,E) | Paper_evidence | WBPaper00045710 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001351 | Paper_evidence | WBPaper00031692 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The paraquat treatment-dependent AAK-2 phosphorylation was absent in aak-2(gt33) and aak-2(ok524) worms | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001482 | Paper_evidence | WBPaper00031692 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The frequency of body bending was reduced by 30% in mutants | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00031692 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | aak-2 mutant worms showed hypersensitivity to hydrogen peroxide | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001858 | Paper_evidence | WBPaper00031692 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants also showed a reduced ability to suppress head oscillations when touched on the anterior side | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000634 | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Pharyngeal pumping was unaffected in mutants | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00031692 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Egg laying was unaffected in mutants | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001702 | Paper_evidence | WBPaper00031692 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Directional reversal of locomotion was unaffected in mutants | Paper_evidence | WBPaper00031692 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00031692 | |||||||
WBPaper00045710 | ||||||||
WBPaper00048494 | ||||||||
Method | Deletion_allele |