WormBase Tree Display for Variation: WBVar00146378
expand all nodes | collapse all nodes | view schema
WBVar00146378 | Evidence | Paper_evidence | WBPaper00025221 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | gu22 | |||||||
Other_name | CE05215:p.Met57Ile | ||||||||
C04G2.7.1:c.171G>A | |||||||||
HGVSg | CHROMOSOME_IV:g.10109232C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C04G2 | |||||
Flanking_sequences | tgacacagttcgtgctcaaatagtcgaaat | tcacaacatggtacacgaccatgtgacata | |||||||
Mapping_target | C04G2 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00025221 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001204 | |||||||
Transcript | C04G2.7.1 (12) | ||||||||
Genetics | Interpolated_map_position | IV | 4.52959 | ||||||
Description | Phenotype | WBPhenotype:0000183 | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00028561 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001180 | Paper_evidence | WBPaper00028561 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00028561 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Germline corpses were quantified in staged adults (generally 24 hours after L4/adult molt) stained with SYTO12. | Paper_evidence | WBPaper00028561 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00025221 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | gu22 affected the expression of lin-48 in hindgut cells | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | saIs14 [lin-48::GFP] | Paper_evidence | WBPaper00025221 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001297 | Paper_evidence | WBPaper00025221 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | gu22 mutants exhibit defective male tail development | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001298 | Paper_evidence | WBPaper00025221 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | gu22 mutants exhibit defective hindgut development | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001372 | Paper_evidence | WBPaper00025221 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | gu22 protein exhibits reduced DNA binding activity | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000006 | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants retain a high level of function in the egg-laying system | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00025221 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | vulF morphogenesis is normal | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00025221 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006768 | PATO:0000460 | Paper_evidence | WBPaper00025221 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00028561 | ||||||||
WBPaper00025221 | |||||||||
Method | Substitution_allele |