WormBase Tree Display for Variation: WBVar00146526
expand all nodes | collapse all nodes | view schema
WBVar00146526 | Evidence | Paper_evidence | WBPaper00045317 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | h293 | |||||||
Other_name | C55B7.9b.1:c.405+1G>A | ||||||||
C55B7.9a.3:c.588+1G>A | |||||||||
C55B7.9a.2:c.588+1G>A | |||||||||
C55B7.9a.1:c.588+1G>A | |||||||||
HGVSg | CHROMOSOME_I:g.6493044C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C55B7 | |||||
Flanking_sequences | AGTTGAAAAAATAAATTCGAAATTATTACTAAAAAACCTA | CGGCATGTATTCTGCAGACTCGGGCAATGAGATACTGATT | |||||||
Mapping_target | CHROMOSOME_I | ||||||||
Source_location | 200 | CHROMOSOME_I | 6493046 | 6493046 | |||||
Type_of_mutation | Substitution | C | T | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00023756 | ||||||||
Laboratory | KR | ||||||||
Analysis | WGS_Rose | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00007018 | |||||||
Transcript | C55B7.9a.1 | VEP_consequence | splice_donor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C55B7.9a.1:c.588+1G>A | ||||||||
Intron_number | 6/7 | ||||||||
C55B7.9a.3 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C55B7.9a.3:c.588+1G>A | ||||||||
Intron_number | 8/9 | ||||||||
C55B7.9b.1 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C55B7.9b.1:c.405+1G>A | ||||||||
Intron_number | 5/6 | ||||||||
C55B7.9a.2 | VEP_consequence | splice_donor_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C55B7.9a.2:c.588+1G>A | ||||||||
Intron_number | 7/8 | ||||||||
Genetics | Interpolated_map_position | I | 1.15731 | ||||||
Mapping_data | In_2_point | 5230 | |||||||
5231 | |||||||||
In_pos_neg_data (14) | |||||||||
Description | Phenotype | WBPhenotype:0000052 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00040589 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00003985 | |||||||
WBPaper00002829 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sterile adult mutants had a normal life-span of two to three weeks and grew to the expected size for Unc-13 adults (0.6+/-0.8 mm); homozygotes for let-604(h293) showed gamete differentiation in the loop region, with oocytes and fertilized eggs in the proximal region. However, the eggs did not develop past gastrulation, since no signs ofmorphogenesis were visible; none of the eggs were laid, and they became necrotic within the gonad | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000324 | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals bearing the other allele of let-604, h293, grew to the full length expected for an adult. | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000670 | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | none of the sterile mutants were rescued by wild-type sperm, thereforenone of them had defects in spermatogenesis alone. | Paper_evidence | WBPaper00002829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00002829 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | dpy-5 unc-13; sDp2 | Paper_evidence | WBPaper00002829 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040589 | ||||||||
WBPaper00002829 | |||||||||
WBPaper00000975 | |||||||||
WBPaper00003985 | |||||||||
WBPaper00000699 | |||||||||
WBPaper00045317 | |||||||||
Method | Substitution_allele |