WormBase Tree Display for Variation: WBVar00191258
expand all nodes | collapse all nodes | view schema
WBVar00191258 | Name | Public_name | WBVar00191258 | ||
---|---|---|---|---|---|
Other_name | haw58534 | ||||
CE52824:p.Lys110= | |||||
C53B4.2.1:c.330G>A | |||||
HGVSg | CHROMOSOME_IV:g.8966646G>A | ||||
Sequence_details | SMap | S_parent | Sequence | C53B4 | |
Flanking_sequences | GAGAAAAAAGATTCGAGTGCGCCATTGAAGAAACTGTCAGAAGAGAAAAA | AAAAGTTCTCGAGCAAGAGGAAAAGAGAATATGGGTCCAGGATCAGATAG | |||
Mapping_target | C53B4 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | SNP | ||||
Predicted_SNP | |||||
Natural_variant | |||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004602 | From_analysis | WGS_Hawaiian_Waterston | ||
Laboratory | RW | ||||
Person | WBPerson1562 | ||||
Analysis | WGS_Hawaiian_Waterston | ||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00008272 | |||
Transcript | C53B4.2.1 | VEP_consequence | synonymous_variant | ||
VEP_impact | LOW | ||||
HGVSc | C53B4.2.1:c.330G>A | ||||
HGVSp | CE52824:p.Lys110= | ||||
cDNA_position | 358 | ||||
CDS_position | 330 | ||||
Protein_position | 110 | ||||
Exon_number | 4/8 | ||||
Codon_change | aaG/aaA | ||||
Amino_acid_change | K | ||||
Remark | [20081124 db] this Variation was previously named hw58534 | ||||
This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf898900 | |||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Method | WGS_Hawaiian_Waterston |