WormBase Tree Display for Variation: WBVar00194873
expand all nodes | collapse all nodes | view schema
| WBVar00194873 | Name | Public_name | WBVar00194873 | ||
|---|---|---|---|---|---|
| Other_name | haw62149 | ||||
| Sequence_details | Flanking_sequences | AATAAAAAAACTAATTTCTCTCATAATTTATTTTACCCTGGAGAATCGGG | AAAACATCTTACTTTATTTTAAAAAAATAGAGAAAGCAGTCTGAAACATT | ||
| Mapping_target | Y64G10A | ||||
| Type_of_mutation | Substitution | A | G | ||
| SeqStatus | Sequenced | ||||
| Variation_type | SNP | ||||
| Predicted_SNP | |||||
| Natural_variant | |||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00004602 | ||||
| Laboratory | RW | ||||
| Person | WBPerson1562 | ||||
| Analysis | WGS_Hawaiian_Waterston | ||||
| Status | Dead | ||||
| Remark | [20081124 db] this Variation was previously named hw62149 | ||||
| This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf267916 | |||
| This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
| (Re)suppressed because on closer inspection is made invalid by a genome sequence correction | Feature_evidence | WBsf267916 | |||
| [Suppressed] This gene was previously annotaed as supressed. | |||||
| Method | WGS_Hawaiian_Waterston |
