WormBase Tree Display for Variation: WBVar00241245
expand all nodes | collapse all nodes | view schema
WBVar00241245 | Name | Public_name | qm37 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | qm37tsmat | |||||||
CE30240:p.Cys772Tyr | ||||||||
C07H6.6.1:c.2315G>A | ||||||||
HGVSg | CHROMOSOME_III:g.7515811C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C07H6 | ||||
Flanking_sequences | tcatggttgcatcgatggtttatgtgagat | tggcgtatgtcctcaaattcatcgaatgtc | ||||||
Mapping_target | C07H6 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00004941 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (4) | ||||||||
Laboratory | MQ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000537 | ||||||
Transcript | C07H6.6.1 (12) | |||||||
Interactor | WBInteraction000009170 | |||||||
WBInteraction000009171 | ||||||||
WBInteraction000050636 | ||||||||
WBInteraction000050638 | ||||||||
WBInteraction000517493 | ||||||||
Genetics | Interpolated_map_position | III | -0.724776 | |||||
Mapping_data | In_multi_point | 2742 | ||||||
2743 | ||||||||
Description | Phenotype | WBPhenotype:0000043 | Paper_evidence | WBPaper00003496 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants develop more slowly than N2. | Paper_evidence | WBPaper00003496 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000050 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | embryonic lethal at 25C, some lethality at all temperatures | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000120 | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited a significant decrease in SOD-1 protein. | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000676 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slow growth; profound maternal and zygotic rescue | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000741 | Paper_evidence | WBPaper00031868 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exposed to nitrogen (HN2) showed no apoptotic corpses in the germ line, whereas corpses were observed in N2 animals. | Paper_evidence | WBPaper00031868 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were treated with 400uM HN2. | Paper_evidence | WBPaper00031868 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001663 | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | At 0.2 mm paraquat, worms developed as well as wild-type worms. At a higher concentration of 0.3mM paraquat, we found that worms grew to a further developmental stage than wild-type worms. | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004938 | Paper_evidence | WBPaper00036073 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBMol:00002747 | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001711 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | slow rhythms, phenotypes similar to Clk-1; profound maternal and zygotic rescue | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002163 | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Measurement of whole-worm oxygen consumption in day 1 adult worms revealed that Clk mutants showed decreased oxygen consumption compared to wild-type worms. | Unlike control animals, the Clk mutants do not show any decrease in oxygen consumption from day 1 to day 7. | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000641 | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | clk-2 mutants remained mobile as long as wild-type worms. | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001574 | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ATP levels are normal despite decreased mitochondrial function. | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference (14) | ||||||||
Method | Substitution_allele |