WormBase Tree Display for Variation: WBVar00241266
expand all nodes | collapse all nodes | view schema
WBVar00241266 | Evidence | Paper_evidence | WBPaper00036073 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | qm162 | |||||||
Other_name | CE37947:p.Cys67Tyr | ||||||||
ZK637.9.1:c.200G>A | |||||||||
HGVSg | CHROMOSOME_III:g.8912403G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | |||||
Flanking_sequences | agagtttcgtcgaatggcctcatattatct | cggagatttcgattcaataaataaacagat | |||||||
Mapping_target | ZK637 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024553 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026666 | ||||||||
Laboratory | MQ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00014027 | |||||||
Transcript | ZK637.9.1 (12) | ||||||||
Interactor | WBInteraction000517496 | ||||||||
Genetics | Interpolated_map_position | III | 0.0102613 | ||||||
Mapping_data | In_multi_point | 5435 | |||||||
Description | Phenotype | WBPhenotype:0000042 | Paper_evidence | WBPaper00036073 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00036073 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000061 | Paper_evidence | WBPaper00036073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00036073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000207 | Paper_evidence | WBPaper00036073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slow defecation | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000463 | Paper_evidence | WBPaper00041750 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | tpk-1(qm162) mutants were found to produce several metabolite compounds in significantly altered amounts relative to wild-type worms (Figure 3). | Paper_evidence | WBPaper00041750 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000641 | Paper_evidence | WBPaper00036073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Clk mutants had a longer period of mobility than wild-type worms. | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000674 | Paper_evidence | WBPaper00036073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000022 | PATO:0000460 | Paper_evidence | WBPaper00036073 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002163 | Paper_evidence | WBPaper00036073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Measurement of whole-worm oxygen consumption in day 1 adult worms revealed that Clk mutants showed decreased oxygen consumption compared to wild-type worms. | Like control animals, the Clk mutants show a decrease in oxygen consumption from day 1 to day 7. | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000112 | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants failed to show any increase in SOD-2 and levels of SOD-1 were unchanged. | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001574 | Paper_evidence | WBPaper00036073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ATP levels are normal despite decreased mitochondrial function. | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001621 | Paper_evidence | WBPaper00036073 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At 0.2 mm paraquat, worms developed as well as wild-type worms. | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule (2) | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00036073 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00041750 | ||||||||
WBPaper00036073 | |||||||||
Method | Substitution_allele |