WormBase Tree Display for Variation: WBVar00241331
expand all nodes | collapse all nodes | view schema
WBVar00241331 | Evidence | Paper_evidence | WBPaper00005804 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | r367ra202 | |||||
Other_name | C47E8.7.1:c.283G>A | ||||||
CE05443:p.Glu95Lys | |||||||
HGVSg | CHROMOSOME_V:g.14694935C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C47E8 | |||
Flanking_sequences | acacaattggagttcacaccaatgcataaa | aagcaagaattcagttaccagatatgcaaa | |||||
Mapping_target | C47E8 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005804 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | TR | ||||||
DM | |||||||
Status | Live | ||||||
Linked_to (2) | |||||||
Affects | Gene | WBGene00006836 | |||||
Transcript | C47E8.7.1 (12) | ||||||
Genetics | Interpolated_map_position | V | 6.70021 | ||||
Reference | WBPaper00005804 | ||||||
Remark | ra202 is a revertant of r367. The allele alteration is same as the revertants ra233 and ra236 | Paper_evidence | WBPaper00005804 | ||||
Cis double mutant | |||||||
Method | Substitution_allele |