WormBase Tree Display for Variation: WBVar00241391
expand all nodes | collapse all nodes | view schema
WBVar00241391 | Evidence | Paper_evidence | WBPaper00005723 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | r860 | ||||||
Other_name | CE25134:p.Gln17Ter | |||||||
W02D3.8.1:c.49C>T | ||||||||
HGVSg | CHROMOSOME_I:g.6736104G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | W02D3 | ||||
Flanking_sequences | gtcactgaaaagttcaaacgatattgtaat | aactggaaaaatacggccaaactgaaaatg | ||||||
Mapping_target | W02D3 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00034942 | |||||||
WBStrain00034944 | ||||||||
Laboratory | TR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004883 | ||||||
Transcript | W02D3.8.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | W02D3.8.1:c.49C>T | |||||||
HGVSp | CE25134:p.Gln17Ter | |||||||
cDNA_position | 58 | |||||||
CDS_position | 49 | |||||||
Protein_position | 17 | |||||||
Exon_number | 2/7 | |||||||
Codon_change | Caa/Taa | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000519069 | |||||||
WBInteraction000519085 | ||||||||
Genetics | Interpolated_map_position | I | 1.3019 | |||||
Mapping_data | In_2_point | 4745 | ||||||
In_multi_point | 1689 | |||||||
1891 | ||||||||
1892 | ||||||||
Description | Phenotype | WBPhenotype:0000506 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | adult male has swollen bursa | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000508 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | unc-54 nonsense RNAs accumulate | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000697 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | adult hermaphrodite has protruding vulva | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001538 | Paper_evidence (2) | |||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Isolated as a suppressor of unc-54(r293). This allele exhibits morphological abnormalities in the genitalia. Suppresses paralysis in unc-54(r293), sterility in tra-2(e1209), Egl and alae defects in lin-29(n546) and Dpy phenotype in dpy-5(e61) | Paper_evidence | WBPaper00001192 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Increases the steady state level of unc-54 mutant mRNAs (altered 3' UTR and nonsense mutations). | Paper_evidence | WBPaper00001813 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence (2) | |||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001828 | Paper_evidence | WBPaper00004325 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant smg-5 animals recovered rapidly from unc-54 RNAi-induced paralysis, unlike wild-type | Paper_evidence | WBPaper00004325 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | RNAi injection | Paper_evidence | WBPaper00004325 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00014415 | |||||||
WBPaper00004325 | ||||||||
WBPaper00001192 | ||||||||
WBPaper00001813 | ||||||||
WBPaper00013850 | ||||||||
Method | Substitution_allele |