WormBase Tree Display for Variation: WBVar00241397
expand all nodes | collapse all nodes | view schema
WBVar00241397 | Evidence | Paper_evidence | WBPaper00003648 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | r866 | |||||
Other_name | CE28367:p.Gly470Arg | ||||||
Y48G8AL.6.1:c.1408G>A | |||||||
HGVSg | CHROMOSOME_I:g.1180576G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | Y48G8AL | |||
Flanking_sequences | ccgacctttaagcttgattcaaggacctccg | gaactggaaaaaccgtagtttcggcgacaa | |||||
Mapping_target | Y48G8AL | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003648 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | TR | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004880 | |||||
Transcript | Y48G8AL.6.1 (12) | ||||||
Genetics | Interpolated_map_position | I | -16.9143 | ||||
Description | Phenotype | WBPhenotype:0001538 | Paper_evidence | WBPaper00001192 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Isolated as a suppressor of unc-54(r293). This allele exhibits morphological abnormalities in the genitalia | Paper_evidence | WBPaper00001192 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Recessive | Paper_evidence | WBPaper00001192 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00001192 | ||||||
Method | Substitution_allele |