WormBase Tree Display for Variation: WBVar00241400
expand all nodes | collapse all nodes | view schema
| WBVar00241400 | Evidence | Paper_evidence | WBPaper00005723 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | r869 | |||||
| Other_name | CE25134:p.Trp292Ter | ||||||
| W02D3.8.1:c.875G>A | |||||||
| HGVSg | CHROMOSOME_I:g.6735043C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | W02D3 | |||
| Flanking_sequences | ccaaatgccttctagctgaagctatctcat | gatttccgattcagccgaaatactcggaca | |||||
| Mapping_target | W02D3 | ||||||
| Type_of_mutation | Substitution | g | a | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | TR | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00004883 | |||||
| Transcript | W02D3.8.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | W02D3.8.1:c.875G>A | ||||||
| HGVSp | CE25134:p.Trp292Ter | ||||||
| cDNA_position | 884 | ||||||
| CDS_position | 875 | ||||||
| Protein_position | 292 | ||||||
| Exon_number | 5/7 | ||||||
| Codon_change | tGg/tAg | ||||||
| Amino_acid_change | W/* | ||||||
| Genetics | Interpolated_map_position | I | 1.30165 | ||||
| Description | Phenotype | WBPhenotype:0001538 | Paper_evidence | WBPaper00001192 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Isolated as a suppressor of unc-54(r293). This allele exhibits morphological abnormalities in the genitalia | Paper_evidence | WBPaper00001192 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Recessive | Paper_evidence | WBPaper00001192 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00001192 | ||||||
| Method | Substitution_allele |
