WormBase Tree Display for Variation: WBVar00241413
expand all nodes | collapse all nodes | view schema
WBVar00241413 | Evidence | Paper_evidence | WBPaper00001192 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | r884 | |||||
Other_name | CE53740:p.Trp1943Ter | ||||||
CE30258:p.Trp1941Ter | |||||||
C48B6.6b.1:c.5829G>A | |||||||
C48B6.6a.1:c.5823G>A | |||||||
HGVSg | CHROMOSOME_I:g.6903267C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C48B6 | |||
Flanking_sequences | ttggatgcgtgcgaatgatgcaacaacttg | tggtcggttacaaaacgatattcaagatca | |||||
Mapping_target | C48B6 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024418 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | TR | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004879 | |||||
Transcript (2) | |||||||
Genetics | Interpolated_map_position | I | 1.47328 | ||||
Description | Phenotype | WBPhenotype:0001538 | Paper_evidence | WBPaper00001192 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Isolated as a suppressor of unc-54(r293). This allele exhibits morphological abnormalities in the genitalia | Paper_evidence | WBPaper00001192 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Recessive | Paper_evidence | WBPaper00001192 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00001192 | ||||||
Method | Substitution_allele |