WormBase Tree Display for Variation: WBVar00241454
expand all nodes | collapse all nodes | view schema
WBVar00241454 | Evidence | Paper_evidence | WBPaper00018906 | ||||
---|---|---|---|---|---|---|---|
Person_evidence | WBPerson453 | ||||||
Name | Public_name | r1162 | |||||
Other_name (16) | |||||||
HGVSg | CHROMOSOME_V:g.6902386_6906045del | ||||||
Sequence_details | SMap | S_parent | Sequence | K11C4 | |||
Flanking_sequences | agctctccgaaagcgtcgatgatcaaacct | aaaaaaaaactataaaattcaagcaaatca | |||||
Mapping_target | K11C4 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Pending_curation | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00030699 | ||||||
WBStrain00030700 | |||||||
WBStrain00034950 | |||||||
WBStrain00040880 | |||||||
WBStrain00040882 | |||||||
WBStrain00056731 | |||||||
Laboratory | TR | ||||||
EN | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006801 | |||||
Transcript (16) | |||||||
Interactor | WBInteraction000519345 | ||||||
Isolation | Mutagen | Tc1 | |||||
Genetics | Interpolated_map_position | V | 0.459264 | ||||
Description | Phenotype (6) | ||||||
Phenotype_not_observed | WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00040284 | ||||||
WBPaper00018906 | |||||||
WBPaper00066013 | |||||||
Remark | Variation information submitted by WBPerson453 on 2022-11-17_09:04:46 via the Allele submission form. Submitted data refers to the negative strand. | Curator_confirmed | WBPerson51134 | ||||
Submitted comments: Mutation starts and ends in introns, the theoretical spliced mRNA has a frameshift and has a STOP codon after the protein sequenceFERQIKNVDAHGANELLLRHLSSKIRHRSRQDRLGAQ, 30 bp upstream: AAGgtacccacagacactgtagttttgtgtttgattcggttgcgttccacatctaatctattaaaattctcaaactctccaatagattgtgaataacccaacacccccttctaacccctaaaccaatttgcagAACGTTGACGCCCATGGCGCAAACGAACTGCTCTTACGTCACCTCTCATCGAAAATTCGACATCGATCCCGGCAAGATCGCCTCGGCGCACAGgtttcgagcccgcatattatctctatcaactgtcttttttcgcctgatttgcttgaattttatagttttttttt, 30 bp downstream: agGTTTGATCATCGACGCTTTCGGAGAGCTTCGTGATCAACAAGAATCTGCAACTGAGAAGCTCGAGTCATCATGTTTCATTTGCGACATCGGCAAAGAAACGTTTGATCGGATGCCTCGAGGCTTCGAAATTCACACCACCAAAGAGCACAACTTTGCCAATTACCTgtatgttaaatgcttttattcaactgttctaacttttcaaacttctagGTTCTTCTTACAACATCTGGTCAACAAAGACGAAACAGAGTACACTGGTCAAGAAACGTACGTACGTGAGAAGTACGATAATCG We obtained this strain from the CGC and sequenced the deletion. | Person_evidence | WBPerson453 | |||||
Curator_confirmed | WBPerson51134 | ||||||
Method | Deletion_allele |