WormBase Tree Display for Variation: WBVar00241457
expand all nodes | collapse all nodes | view schema
WBVar00241457 | Evidence | Paper_evidence | WBPaper00004705 | ||
---|---|---|---|---|---|
Name | Public_name | r1181 | |||
Other_name | F46B6.3b.1:c.140+1G>A | ||||
F46B6.3a.1:c.140+1G>A | |||||
HGVSg | CHROMOSOME_V:g.9777602C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F46B6 | |
Flanking_sequences | tggaacctattttcatcctgctaacttttc | tgtgttctaaaaatttgatgttttgcttct | |||
Mapping_target | F46B6 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Laboratory | TR | ||||
Status | Live | ||||
Affects (2) | |||||
Genetics | Interpolated_map_position | V | 2.19429 | ||
Reference | WBPaper00004705 | ||||
Remark | Substitution is at the beginning of the first intron [030411 ck1] | ||||
Method | Substitution_allele |