WormBase Tree Display for Variation: WBVar00241459
expand all nodes | collapse all nodes | view schema
WBVar00241459 | Evidence | Paper_evidence | WBPaper00003389 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | r1197 | |||||
Other_name | CE25584:p.Leu204Ter | ||||||
Y73B6A.4.1:c.611T>A | |||||||
HGVSg | CHROMOSOME_IV:g.6741524A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y73B6A | |||
Flanking_sequences | cgatttgcaaaatttttgaaaatattcgtt | agccaccagaagcagttgggaattccatag | |||||
Mapping_target | Y73B6A | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00034952 | ||||||
Laboratory | TR | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004885 | |||||
Transcript | Y73B6A.4.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | Y73B6A.4.1:c.611T>A | ||||||
HGVSp | CE25584:p.Leu204Ter | ||||||
cDNA_position | 624 | ||||||
CDS_position | 611 | ||||||
Protein_position | 204 | ||||||
Exon_number | 5/9 | ||||||
Codon_change | tTa/tAa | ||||||
Amino_acid_change | L/* | ||||||
Genetics | Interpolated_map_position | IV | 3.22051 | ||||
Reference | WBPaper00003389 | ||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |