WormBase Tree Display for Variation: WBVar00241498

WBVar00241498 Name: Public_name: re1
    Other_name: C48B6.6a.1:c.6277G>T
      CE53740:p.Glu2095Ter
      C48B6.6b.1:c.6283G>T
      CE30258:p.Glu2093Ter
    HGVSg: CHROMOSOME_I:g.6902709C>A
  Sequence_details: SMap: S_parent: Sequence: C48B6
    Flanking_sequences: aaagctaaagaaagattgaccgatgcgatg agttactcaatttgagaatgtctgaggttc
    Mapping_target: C48B6
    Type_of_mutation: Substitution: g t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00008389
    Laboratory: DV
    Status: Live
  Affects: Gene: WBGene00004879
    Transcript: C48B6.6b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C48B6.6b.1:c.6283G>T
        HGVSp: CE53740:p.Glu2095Ter
        cDNA_position: 6283
        CDS_position: 6283
        Protein_position: 2095
        Exon_number: 36/42
        Codon_change: Gag/Tag
        Amino_acid_change: E/*
      C48B6.6a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: C48B6.6a.1:c.6277G>T
        HGVSp: CE30258:p.Glu2093Ter
        cDNA_position: 6305
        CDS_position: 6277
        Protein_position: 2093
        Exon_number: 37/44
        Codon_change: Gag/Tag
        Amino_acid_change: E/*
    Interactor: WBInteraction000525289
  Genetics: Interpolated_map_position: I 1.47211
  Description: Phenotype: WBPhenotype:0000697 Person_evidence: WBPerson516
        Curator_confirmed: WBPerson712
        Remark: Please see CGC note, D. Reiner found this Smg suppressor in the background of HE110 unc-97(su110). It partially suppresses the Unc and also confers a pVul phenotype. re1 was detected by WGS and confirmed with PCR. Person_evidence: WBPerson516
            Curator_confirmed: WBPerson712
  Method: Substitution_allele