WormBase Tree Display for Variation: WBVar00241599

WBVar00241599 Evidence: Paper_evidence: WBPaper00004181
  Name: Public_name: rh286
    Other_name (15)
    HGVSg: CHROMOSOME_X:g.10664082G>A
  Sequence_details: SMap: S_parent: Sequence: F11A1
    Flanking_sequences: acaaacggatgaacatgttttacgaaaatt catccaatcggctctcgacagcccagaaaa
    Mapping_target: F11A1
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00004181
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00000007
    Laboratory: NJ
    Status: Live
  Affects: Gene: WBGene00000908
    Transcript: F11A1.3b.1 (12)
      F11A1.3e.2 (12)
      F11A1.3e.1 (12)
      F11A1.3e.4 (12)
      F11A1.3f.1 (12)
      F11A1.3a.1 (12)
      F11A1.3g.1 (12)
      F11A1.3e.3 (12)
      F11A1.3d.1 (12)
  Genetics: Interpolated_map_position: X 2.36907
  Description: Phenotype: WBPhenotype:0000137 Paper_evidence: WBPaper00034661
        Curator_confirmed: WBPerson2987
        Remark: The daf-12(rh286) mutation resulted in reduced induction of mRNA expression of the genes mtl-2 and sod-3 in response to silver nanoparticle (AgNP) exposure, compared to wild type animals and as determined by qRT-PCR (Figure 4 compared to Figure 3A). Paper_evidence: WBPaper00034661
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00005288 Paper_evidence: WBPaper00034661
              Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000591 Paper_evidence: WBPaper00034661
        Curator_confirmed: WBPerson2987
        Remark: daf-12(rh286) mutants exhibited a wild type response to the toxic effects of silver nanoparticles on reproduction (Table 1) Paper_evidence: WBPaper00034661
            Curator_confirmed: WBPerson2987
        Affected_by: Molecule: WBMol:00005288 Paper_evidence: WBPaper00034661
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00004181
    WBPaper00034661
  Method: Substitution_allele