WormBase Tree Display for Variation: WBVar00241753
expand all nodes | collapse all nodes | view schema
WBVar00241753 | Evidence | Paper_evidence | WBPaper00048558 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | s180 | ||||||
Other_name | s155 | Paper_evidence | WBPaper00000321 | |||||
CE33587:p.Gln29Ter | ||||||||
Y18H1A.7a.1:c.85C>T | ||||||||
HGVSg | CHROMOSOME_I:g.719551G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y18H1A | ||||
Flanking_sequences | cgccgatttatcgccagccggccagttatc | agttcgatcggcgaccaggatacgttccga | ||||||
Mapping_target | Y18H1A | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00048558 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (22) | ||||||||
Laboratory | BC | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004332 | ||||||
Transcript | Y18H1A.7a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y18H1A.7a.1:c.85C>T | |||||||
HGVSp | CE33587:p.Gln29Ter | |||||||
cDNA_position | 345 | |||||||
CDS_position | 85 | |||||||
Protein_position | 29 | |||||||
Exon_number | 3/7 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Genetics | Interpolated_map_position | I | -18.5548 | |||||
Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00032296 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Seven out of sixteen synapsed homolog pairs showed a ZHP-3 focus near the center of the chromosome, in contrast to four of five synapsed homolog pairs in wild-type animals with a ZHP-3 focus closer to one end. | Paper_evidence | WBPaper00032296 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000742 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | increases meiotic recombination in gene clusters, reduces recombination on chromosome arms; distribution of crossovers in Rec-1 approximates physical map. | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES1_Very_hard_to_score (2) | |||||||
Phenotype_not_observed | WBPhenotype:0000143 | Paper_evidence | WBPaper00000565 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | UV sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 1Jm 10X-2/sec. Irradiated animals were protected from light. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000276 | Paper_evidence | WBPaper00000565 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | X-ray sensitivities were measured as % survival based on radiation dose. Alkaline bleach isolated eggs ranging in age from 30-180 minutes were aliquoted to plates to give between 25-300 survivors/plate. The plated eggs were irradiated at different doses at a rate of 470 r/min. Survival was scored as the % animals reaching adulthood 4-6 days after irradiation relative to un-irradiated controls. | Paper_evidence | WBPaper00000565 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00000565 | |||||||
WBPaper00016442 | ||||||||
WBPaper00032296 | ||||||||
WBPaper00048558 | ||||||||
Method | Substitution_allele |