WormBase Tree Display for Variation: WBVar00242148
expand all nodes | collapse all nodes | view schema
WBVar00242148 | Evidence | Paper_evidence | WBPaper00005824 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | s1586 | |||||
Other_name | C38C3.5.1:c.4-352_90+170del | ||||||
HGVSg | CHROMOSOME_V:g.1476530_1477138del | ||||||
Sequence_details | SMap | S_parent | Sequence | C38C3 | |||
Flanking_sequences | ttctcagtatctttattgtttagtgaaatg | tagcgctacagtagtcatttaaaggattac | |||||
Mapping_target | C38C3 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | BC | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00302980 | |||||
WBGene00006794 | |||||||
Transcript | F53E2.2.1 | VEP_consequence | 3_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
cDNA_position | 1009-? | ||||||
Exon_number | 7/7 | ||||||
C38C3.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | C38C3.5.1:c.4-352_90+170del | ||||||
Intron_number | 2-3/6 | ||||||
Exon_number | 3/7 | ||||||
Interactor | WBInteraction000519090 | ||||||
Genetics | Interpolated_map_position | V | -18.8773 | ||||
Description | Phenotype | WBPhenotype:0000057 | Paper_evidence | WBPaper00001474 | |||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000058 | Paper_evidence | WBPaper00005824 | |||||
Curator_confirmed | WBPerson48 | ||||||
Recessive | Paper_evidence | WBPaper00005824 | |||||
Curator_confirmed | WBPerson48 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00005824 | ||||
Curator_confirmed | WBPerson48 | ||||||
Reference | WBPaper00014568 | ||||||
WBPaper00021016 | |||||||
WBPaper00001474 | |||||||
WBPaper00014773 | |||||||
WBPaper00005824 | |||||||
Remark | Flanking sequences are 30 bp to the left of nt 1392 and 30 bp to the right of 2000 nt of C38C3 - estimated from Fig. 8A of cgc5824 as no precise coordinates are available | Curator_confirmed | WBPerson1845 | ||||
s1586 is a deletion that completely removes exon 2B and approx. 250 bp of the 3' UTR in exon 5A | Paper_evidence | WBPaper00005824 | |||||
Method | Deletion_allele |