WormBase Tree Display for Variation: WBVar00242371
expand all nodes | collapse all nodes | view schema
| WBVar00242371 | Evidence | Paper_evidence | WBPaper00003796 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | s2613 | |||||
| Other_name | CE24786:p.Arg318Ter | ||||||
| C05D11.4.1:c.952C>T | |||||||
| HGVSg | CHROMOSOME_III:g.6409266C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C05D11 | |||
| Flanking_sequences | gagctcaaaagtcttcgtgaagaagaactc | gacgtcgttatcaacaacaacagcagcaac | |||||
| Mapping_target | C05D11 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003796 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000805 | ||||||
| WBStrain00007480 | |||||||
| WBStrain00030728 | |||||||
| WBStrain00030730 | |||||||
| WBStrain00030732 | |||||||
| Laboratory | BC | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00002881 | |||||
| Transcript | C05D11.4.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C05D11.4.1:c.952C>T | ||||||
| HGVSp | CE24786:p.Arg318Ter | ||||||
| cDNA_position | 960 | ||||||
| CDS_position | 952 | ||||||
| Protein_position | 318 | ||||||
| Exon_number | 9/10 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| Interactor (194) | |||||||
| Genetics | Interpolated_map_position | III | -1.28582 | ||||
| Description | Phenotype | WBPhenotype:0001645 | Paper_evidence | WBPaper00006119 | |||
| Curator_confirmed | WBPerson1754 | ||||||
| Remark | n1377 and s2613 together, but not individually, block the protein degradation observed in clr-1(e1745) | Paper_evidence | WBPaper00006119 | ||||
| Curator_confirmed | WBPerson1754 | ||||||
| Phenotype_not_observed | WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00015389 | ||||||
| WBPaper00026334 | |||||||
| WBPaper00032446 | |||||||
| WBPaper00006119 | |||||||
| WBPaper00003796 | |||||||
| WBPaper00011561 | |||||||
| WBPaper00019544 | |||||||
| Method | Substitution_allele |
