WormBase Tree Display for Variation: WBVar00248713
expand all nodes | collapse all nodes | view schema
WBVar00248713 | Evidence | Paper_evidence | WBPaper00023507 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | st89 | |||||
Other_name | T22B2.4b.1:c.230G>A | ||||||
CE13934:p.Gly77Glu | |||||||
T22B2.4b.2:c.230G>A | |||||||
CE42801:p.Gly77Glu | |||||||
T22B2.4a.1:c.230G>A | |||||||
HGVSg | CHROMOSOME_X:g.3905061G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T22B2 | |||
Flanking_sequences | tcactgatcgtaacacacaaaaaagcagag | atatggatttgtaagtcactggaatgtcaa | |||||
Mapping_target | T22B2 | ||||||
Type_of_mutation | Substitution | g | a | ||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00033510 | ||||||
Laboratory | RW | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006321 | |||||
Transcript | T22B2.4b.2 (12) | ||||||
T22B2.4a.1 (12) | |||||||
T22B2.4b.1 (12) | |||||||
Interactor | WBInteraction000502010 | ||||||
WBInteraction000519073 | |||||||
WBInteraction000519088 | |||||||
WBInteraction000519089 | |||||||
WBInteraction000542002 | |||||||
WBInteraction000542003 | |||||||
WBInteraction000542004 | |||||||
Genetics | Interpolated_map_position | X | -9.16696 | ||||
Mapping_data | In_2_point | 1820 | |||||
In_multi_point | 794 | ||||||
Description | Phenotype | WBPhenotype:0000926 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | minor changes in body wall muscle ultrastructure | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001355 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | abnormal gonad and minor changes in body wall muscle ultrastructure ES3 in presence of e677 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00023507 | ||||||
Method | Substitution_allele |