WormBase Tree Display for Variation: WBVar00248846
expand all nodes | collapse all nodes | view schema
WBVar00248846 | Evidence | Paper_evidence | WBPaper00003361 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | su110 | ||||||
Other_name | F14D12.2.1:c.900-1G>A | |||||||
HGVSg | CHROMOSOME_X:g.5594366G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | F14D12 | ||||
Flanking_sequences | tgatgaaaacaaattaatgtatgcattgca | aacgaaattctatgaattcgatatgaaacc | ||||||
Mapping_target | F14D12 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00006435 | |||||||
WBStrain00008389 | ||||||||
Laboratory | HE | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006826 | ||||||
Transcript | F14D12.2.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F14D12.2.1:c.900-1G>A | |||||||
Intron_number | 7/8 | |||||||
Interactor | WBInteraction000525289 | |||||||
WBInteraction000555302 | ||||||||
Genetics | Interpolated_map_position | X | -4.48283 | |||||
Mapping_data | In_2_point | 396 | ||||||
397 | ||||||||
In_multi_point | 1207 | |||||||
5465 | ||||||||
Description | Phenotype | WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit fewer dorsal and ventral muscle arms compared to controls. | Paper_evidence | WBPaper00032907 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00032446 | |||||||
WBPaper00004883 | ||||||||
WBPaper00032907 | ||||||||
WBPaper00025869 | ||||||||
WBPaper00015518 | ||||||||
Remark | This transition occurs in a highly conserved splice acceptor site | Paper_evidence | WBPaper00003361 | |||||
Method | Substitution_allele |