WormBase Tree Display for Variation: WBVar00248936
expand all nodes | collapse all nodes | view schema
WBVar00248936 | Evidence | Paper_evidence | WBPaper00004721 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | sy192 | |||||||
Other_name | CE05311:p.Thr330Ile | ||||||||
C26C6.2.1:c.989C>T | |||||||||
HGVSg | CHROMOSOME_I:g.7525779C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C26C6 | |||||
Flanking_sequences | attgccacatgacatgtgccacagacacaa | taacattcaatttgtgtttgacgctgtcac | |||||||
Mapping_target | C26C6 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030824 | ||||||||
Laboratory | PS | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001648 | |||||||
Transcript | C26C6.2.1 (12) | ||||||||
Genetics | Interpolated_map_position | I | 2.10036 | ||||||
Mapping_data | In_multi_point | 3230 | |||||||
3231 | |||||||||
Description | Phenotype (9) | ||||||||
Phenotype_not_observed | WBPhenotype:0000641 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Dispersal index in the absence of anesthetic ~0.98 was not significantly different to N2 ~0.90. | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Dispersal assay as reported in Crowder et al.1996; van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00022779 | ||||||||
WBPaper00031936 | |||||||||
WBPaper00004721 | |||||||||
WBPaper00015453 | |||||||||
WBPaper00022171 | |||||||||
Remark | sy192 (T 330 -> I) [030411 ck1] | ||||||||
Method | Substitution_allele |