WormBase Tree Display for Variation: WBVar00248987
expand all nodes | collapse all nodes | view schema
WBVar00248987 | Evidence | Paper_evidence | WBPaper00004721 | |||||
---|---|---|---|---|---|---|---|---|
Name (3) | ||||||||
Sequence_details | SMap | S_parent | Sequence | C09E10 | ||||
Flanking_sequences | caatttccaacaacgtttcccccatttcta | atttcgcgcaatatcgtagttgccaaacac | ||||||
Mapping_target | C09E10 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024616 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | PS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000958 | ||||||
Transcript | C09E10.2d.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | C09E10.2d.1:c.840+200G>A | |||||||
Intron_number | 6/13 | |||||||
C09E10.2c.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | C09E10.2c.1:c.834+200G>A | |||||||
Intron_number | 6/13 | |||||||
C09E10.2a.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09E10.2a.1:c.835-1G>A | |||||||
Intron_number | 7/17 | |||||||
C09E10.2e.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09E10.2e.1:c.742-1G>A | |||||||
Intron_number | 5/14 | |||||||
C09E10.2b.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09E10.2b.1:c.841-1G>A | |||||||
Intron_number | 7/17 | |||||||
Genetics | Interpolated_map_position | X | -18.8703 | |||||
Description | Phenotype | WBPhenotype:0000641 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Dispersal index in the absence of anesthetic ~0.62 is decreased compared to N2 ~0.90. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Dispersal assay as reported in Crowder et al.1996; van Swinderen et al. 1997. | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001618 | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit an EC50 for halothane statistically insignificant from that of N2 as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001705 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | goa-1(syIs17) | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001619 | Paper_evidence | WBPaper00004721 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit an EC50 for isoflurane statistically insignificant from that of N2 as determined by a concentration-response curve based on animal dispersal indexes. | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004563 | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00004721 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | goa-1(syIs17) | Paper_evidence | WBPaper00004721 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00004721 | |||||||
Remark | This allele has the same mutation as sy425 | Paper_evidence | WBPaper00024616 | |||||
Method | Substitution_allele |