WormBase Tree Display for Variation: WBVar00249311
expand all nodes | collapse all nodes | view schema
WBVar00249311 | Name | Public_name | tm259 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | ZK1193.5c.2:c.373-110_699+7del | ||||||||
ZK1193.5a.1:c.997-110_1323+7del | |||||||||
ZK1193.5d.3:c.373-110_690+7del | |||||||||
ZK1193.5c.1:c.373-110_699+7del | |||||||||
ZK1193.5e.1:c.997-110_1314+7del | |||||||||
ZK1193.5d.4:c.373-110_690+7del | |||||||||
ZK1193.5d.1:c.373-110_690+7del | |||||||||
ZK1193.5d.2:c.373-110_690+7del | |||||||||
ZK1193.5d.5:c.373-110_690+7del | |||||||||
HGVSg | CHROMOSOME_X:g.427814_428797del | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZK1193 | |||||
Flanking_sequences | tcgataactagtaatcagtattaatataga | attcagattttcggccgtagtgttaggtct | |||||||
Mapping_target | ZK1193 | ||||||||
Source_location | 7 | CHROMOSOME_X | 427813 | 428798 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm259_external | ||||||||
tm259_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 259 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00022861 | |||||||
Transcript | ZK1193.5c.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1193.5c.2:c.373-110_699+7del | ||||||||
Intron_number | 5-7/8 | ||||||||
Exon_number | 6-7/9 | ||||||||
ZK1193.5e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1193.5e.1:c.997-110_1314+7del | ||||||||
Intron_number | 6-8/8 | ||||||||
Exon_number | 7-8/9 | ||||||||
ZK1193.5c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1193.5c.1:c.373-110_699+7del | ||||||||
Intron_number | 6-8/9 | ||||||||
Exon_number | 7-8/10 | ||||||||
ZK1193.5d.4 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1193.5d.4:c.373-110_690+7del | ||||||||
Intron_number | 5-7/8 | ||||||||
Exon_number | 6-7/9 | ||||||||
ZK1193.5d.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1193.5d.3:c.373-110_690+7del | ||||||||
Intron_number | 6-8/9 | ||||||||
Exon_number | 7-8/10 | ||||||||
ZK1193.5d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1193.5d.1:c.373-110_690+7del | ||||||||
Intron_number | 7-9/10 | ||||||||
Exon_number | 8-9/11 | ||||||||
ZK1193.5d.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1193.5d.2:c.373-110_690+7del | ||||||||
Intron_number | 7-9/10 | ||||||||
Exon_number | 8-9/11 | ||||||||
ZK1193.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1193.5a.1:c.997-110_1323+7del | ||||||||
Intron_number | 7-9/10 | ||||||||
Exon_number | 8-9/11 | ||||||||
ZK1193.5d.5 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZK1193.5d.5:c.373-110_690+7del | ||||||||
Intron_number | 4-6/7 | ||||||||
Exon_number | 5-6/8 | ||||||||
Interactor | WBInteraction000520533 | ||||||||
WBInteraction000536221 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | X | |||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. W.B. Derry: non-Mendelian inheritance. Deletion is unstable extrachromosomal? | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WD | |||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as lethal or sterile by the National Bioresource Project of Japan. Comment to the NBP from Dr. W.B. Derry: non-Mendelian inheritance. Deletion is unstable extrachromosomal? | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FX | ||||||||
WD | |||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00031084 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Homozygous dve-1(tm259) X mutant animals develop normally until 330 min postfertilization , after which they arrest and degenerate (Figure 2B)." | Paper_evidence | WBPaper00031084 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00031084 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00031084 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Though morphologically normal at this early stage of development, homozygous dve-1(tm259) X mutant embryos born to spg-7(RNAi) mothers have attenuated hsp-60pr::gfp expression , whereas wild-type embryos from spg-7(RNAi) mothers express higher levels of hsp-60pr::gfp (Figure 2C) . These findings indicate that activation of the UPRmt in early embryos depends on endogenous dve-1." | Paper_evidence | WBPaper00031084 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | spg-7(RNAi); hsp-60pr::gfp | Paper_evidence | WBPaper00031084 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002268 | Paper_evidence | WBPaper00031084 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To further examine dve-1's effect on mitochondria , we compared the staining pattern of MitoTracker , a mitochon- drial vital dye , in wild-type embryos and early dve-1(tm259) X mutant embryos , following an established protocol ( Jagasia et al. , 2005 ) . In wild-type embryos , MitoTracker staining was most conspicuous in a reticular network surrounding the large DVE-1-positive nuclei of the intestinal precursor cells , whereas staining in the mutant embryos was consistently diminished by 50% ( Figure 2D ) . As MitoTracker is a vital dye taken up actively by the organelle , these observations are consistent with reduced mitochondrial mass , defective membrane potential, or both." | Paper_evidence | WBPaper00031084 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
" To expand on these observations , we sought a marker for mitochondrial mass . A ligand blot assay with a peroxidase-tagged avidin probe identifies a single major species of 75 kDa in worm lysates that is enriched in the mitochondrial fraction and probably corresponds to the biotinylated mitochondrial enzyme propionyl-CoA carboxylase ( Figure S2 ; Benedetti et al. , 2006 ) . Histochemical analysis of fixed embryos with FITC-conjugated avidin re- veals a signal that largely overlaps MitoTracker in dve-1 / + embryos ( Figure S2 ) and is reduced 55% in dve-1 ( tm259 ) X mutant embryos ( Figure 2E ) . These observations are consistent with reduced mitochondrial mass , possibly com- pounded by a functional defect in the mitochondria of the mutant embryos." | Paper_evidence | WBPaper00031084 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00031084 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0005739 | PATO:0000460 | Paper_evidence | WBPaper00031084 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000729 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. C. Yang: normal cell death phenotype. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | FU | ||||||||
WBPhenotype:0002535 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the NBP from Dr. P. Sengputa: normal dye filling. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Laboratory_evidence | PY | ||||||||
Reference | WBPaper00031084 | ||||||||
Remark | 21397/21398-22381/22382 (984 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |