WormBase Tree Display for Variation: WBVar00249359
expand all nodes | collapse all nodes | view schema
WBVar00249359 | Name | Public_name | tm311 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | R03E9.1.1:c.154+23_436-130del | |||||||
HGVSg | CHROMOSOME_X:g.6742662_6743129del | |||||||
Sequence_details | SMap | S_parent | Sequence | R03E9 | ||||
Flanking_sequences | ttcaaatggtaaagacatgacatttcgtaa | ttttccaattagtcccactactcccacaac | ||||||
Mapping_target | R03E9 | |||||||
Source_location | 7 | CHROMOSOME_X | 6742661 | 6743130 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm311_external | |||||||
tm311_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 311 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003163 | ||||||
Transcript | R03E9.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | R03E9.1.1:c.154+23_436-130del | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 3/5 | |||||||
Interactor | WBInteraction000524630 | |||||||
WBInteraction000524631 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. B. Conradt to the National Bioresource Project of Japan: slow growth at 15C (possibly lethal). | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | MD | |||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00061439 | ||||||
Curator_confirmed | WBPerson49407 | |||||||
Phenotype_not_observed (8) | ||||||||
Reference | WBPaper00040863 | |||||||
WBPaper00061439 | ||||||||
Remark | 12683/12684-13151/13152 (468 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |