WormBase Tree Display for Variation: WBVar00249361
expand all nodes | collapse all nodes | view schema
WBVar00249361 | Name | Public_name | tm313 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | T14G12.4a.1:c.109+293_110-125delinsATAT | |||||||
HGVSg | CHROMOSOME_X:g.3741513_3741853delinsATAT | |||||||
Sequence_details | SMap | S_parent | Sequence | T14G12 | ||||
Flanking_sequences | ccgcaacaacatgacagctggtcgccgcgt | atatatttagagctctataattatccgaga | ||||||
Mapping_target | T14G12 | |||||||
Source_location | 7 | CHROMOSOME_X | 3741512 | 3741854 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | atat | ||||||
Deletion | ||||||||
PCR_product | tm313_external | |||||||
tm313_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 313 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene (2) | |||||||
Transcript | T14G12.9 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
T14G12.4a.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | T14G12.4a.1:c.109+293_110-125delinsATAT | |||||||
Intron_number | 2/5 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | X | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000615 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. P. Sengupta to the National Bioresource Project of Japan: normal ciliary structure of AWC, AWB and ADF neurons. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. P. Sengupta to the National Bioresource Project of Japan: not uncoordinated. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 13301/13302-atat-13642/13643 (341 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |