WormBase Tree Display for Variation: WBVar00249387
expand all nodes | collapse all nodes | view schema
WBVar00249387 | Name | Public_name | tm339 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.8148480_8149895delinsAATCGGG | |||||||
Sequence_details | SMap | S_parent | Sequence | T28B8 | ||||
Flanking_sequences | gaaacagggaaataacattttttcgggaga | aaaatcggcacattctctcccacaaattaa | ||||||
Mapping_target | T28B8 | |||||||
Source_location | 7 | CHROMOSOME_I | 8148479 | 8149896 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | AATCGGG | ||||||
Deletion | ||||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 339 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002101 | ||||||
Transcript | T28B8.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 3-5/5 | |||||||
Interactor | WBInteraction000543178 | |||||||
WBInteraction000543200 | ||||||||
WBInteraction000543230 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000637 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. J. Alcedo: non-Daf-c at 25C. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We found that neither deletions in 12 insulins nor knockdown of any of the 40 insulins results in dauers (Fig 1A; Supplemental Table S2)." | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000013 | Paper_evidence | WBPaper00042184 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "After dauer-inducing conditions, all mutants analyzed were capable of forming dauers, indicating that they are not dauer defective (Fig 1B). " | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000039 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. C. Kenyon: normal life span. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | CF | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000540 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. P. Roy: normal muscle arm development | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | RP | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. P.W. Sternberg: normal locomotion. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | PS | |||||||
Reference | WBPaper00042184 | |||||||
Remark | 17514/17515-AATCGGG-18930/18931 (1416 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |